Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for Family With Sequence Similarity 46 Member B FAM46B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and 0.1% amphotericin B solution (Sigma-Aldrich, USA) under aseptic conditions in a humidified 37°C incubator with 5% CO₂ ...
-
bioRxiv - Microbiology 2023Quote: ... 150,000 units polymyxin B sulfate (Sigma, P4932-1MU) and 1 gram active kanamycin monosulfate (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... coated with 0.1% Gelatin (ES-006-B, Millipore). mESCs were maintained in 2i media62 ...
-
bioRxiv - Bioengineering 2023Quote: ... rhodamine B isothiocyanate (5 mg/body; Sigma Aldrich) or Texas Red-Dextran (2.5 mg/body ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 10 mM B-glycerophosphate (Sigma-Aldrich), 10 nM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... and phosphatase inhibitors A and B (from SIGMA)) with sonication 4 times 15 sec on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples of rifamycin B (Sigma Aldrich, SIAL-R0900000) and rifamycin S (TCI America ...
-
bioRxiv - Microbiology 2023Quote: ... and 25 ng/ml amphotericin B (Sigma-Aldrich). HeLa cells obtained from Melanie Marketon’s laboratory and maintained in high glucose DMEM (Corning ...
-
bioRxiv - Microbiology 2023Quote: ... and 25 ng/ml amphotericin B (Sigma-Aldrich). The infected cells were incubated at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.01 mg/mL hygromycin B (Sigma, #H3274) and stored in a cell incubator (HeraCell 150i ...
-
bioRxiv - Immunology 2023Quote: ... B cells were stimulated with 3mM CpG (Sigma), in 96 well flat-bottom plates at 104 cells per well.
-
bioRxiv - Cell Biology 2023Quote: ... 1% Pen-Strep and 1% Amphotericin B (Sigma) to obtain a single cell suspension ...
-
bioRxiv - Developmental Biology 2023Quote: ... aurora B Kinase (Sigma, catalog # A5102, 1:100), and cardiac troponin T (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 1 ng/mL b-FGF (Sigma) and 1% Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2.5 μg/mL amphotericin B (Sigma, Hungary). 5% FCS (PAN-Biotech ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-tubulin (Sigma, clone B-5-1-2), Alexa Fluor 488 conjugated Phalloidin (Invitrogen ...
-
bioRxiv - Bioengineering 2024Quote: ... and 0.25 µg/mL Amphotericin B (Sigma-Aldrich). Medium was changed every 2 days in culture for up to 7 days.
-
bioRxiv - Bioengineering 2024Quote: ... and 0.25 µg/mL Amphotericin B (Sigma-Aldrich). All explants were then immediately loaded into grips with a 10-mm gauge length (with the intrasynovial segment of the FDL situated between the grips ...
-
bioRxiv - Cancer Biology 2023Quote: ... α-tubulin (clone B-5-1-2) (Sigma-Aldrich) and His-tag (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... 1mg/mL collagenase B (Sigma-Aldrich cat#: 11088815001) and 25µg/mL of DNAse I (Sigma-Aldrich Cat# ...
-
bioRxiv - Microbiology 2024Quote: ... and polymyxin B and trimethoprim from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2024Quote: ... solvent B: 84% acetonitrile (Sigma-Aldrich, Hamburg, Germany) with 0.1% formic acid ...
-
bioRxiv - Physiology 2022Quote: ... The oligonucleotide sequences of the synthesized primers (Sigma-Genosys) and the predicted sizes of the PCR products are given below:
-
bioRxiv - Neuroscience 2020Quote: ... Primer sequences (purchased from Sigma or Metabion internacional AG) were checked with BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) ...
-
bioRxiv - Molecular Biology 2021Quote: Pre-designed shRNA sequences (MISSION® shRNA library (Sigma); Table 2 ...
-
bioRxiv - Neuroscience 2021Quote: ... The reverse primer harbors a 3xFLAG sequence (Sigma-Aldrich) to allow the expression analysis ...
-
bioRxiv - Microbiology 2022Quote: The sequences of all primers (Sigma or Eurofins Genomics) used in this study are shown in Table S1.
-
bioRxiv - Cancer Biology 2022Quote: ... pLKO.1-puro carrying a sequence targeting EGFP (Sigma) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... The 3xFlag sequence from p3xFLAG-CMV-7.1 plasmid (Sigma) was inserted downstream of the AID sequence ...
-
bioRxiv - Cancer Biology 2020Quote: ... For DDX5 knockdown the custom sequence AACCGCAACCAUUGACGCCAU (Sigma-Aldrich DDX5 Mission shRNA plasmid DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... The 3xFlag sequence from p3xFLAG-CMV-7.1 plasmid (Sigma) was inserted downstream of the AID sequence ...
-
bioRxiv - Cell Biology 2019Quote: ... Forward siRNA sequences 5’-CAGUGGCAGUGGACAAUUCA[dT][dT]-3’ (Sigma) and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... or a nontargeting control sequence (Scramble; Millipore Sigma, SHC002) in a pLKO.1 vector were used to disrupt the expression of proteins associated with Fe-S cluster homeostasis ...
-
bioRxiv - Neuroscience 2022Quote: ... The Flag-tag protein affinity sequence (DYKDDDDK; Sigma-Aldrich) was added to the N-terminal to facilitate confirmation of expression ...
-
bioRxiv - Pathology 2023Quote: ... Annealed oligonucleotides coding for the guide RNA sequences (Sigma) were cloned into BsaI site of pX602 vector using standard molecular cloning techniques.
-
bioRxiv - Neuroscience 2023Quote: ... In a different sequence we substituted the MafB (Sigma) antibody for c-maf (Novus) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3T3-L1s were changed to serum-free DMEM supplemented with 0.2% BSA FFA-free (Sigma-Aldrich, St. Louis, USA, Catalog 9048-46-8). The media was supplemented with 1% DMSO for negative control or 1uM isoproterenol to induce lipolysis +/- 100 μM Atglistatin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402) antibody (Cell signalling #260; 1:150) and Phalloidin–Tetramethylrhodamine B isothiocyanate (Sigma P1951, 1:500). Anti-rabbit Alexa 405 and FITC (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were sedated with ketamine (10mg/kg) and Cholera Toxin subunit B (CT-B, 10 µl, Sigma C9903, 1% aqueous (sterile)) was injected subcutaneously into the distal and middle finger pads of digits 1-3 of both hands ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a 20 min linear gradient from 5% B to 35% B (A: 20 mM ammonium formate (cat No. 70221, Sigma, USA) in water ...
-
bioRxiv - Neuroscience 2023Quote: Whole‐cell Ca2+ currents were recorded in the amphotericin B‐perforated patch configuration (120 µg ml−1 amphotericin B; Sigma‐Aldrich) under voltage‐clamp conditions ...
-
bioRxiv - Microbiology 2023Quote: ... to which was added 2.5% olive oil and 0.001% Rhodamine B (starting from a Rhodamine B stock solution of 1 mg per ml in water; Sigma-Aldrich, Fr) as described (Araiza-Villanueva et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were rinsed with PBS and stained according to manufacturer’s protocol (Millipore #BG-6-B, #BG-7-B, #BG-8-C). Embryos were then fixed again in 4% PFA (in PBS ...
-
bioRxiv - Microbiology 2020Quote: The sequences encoding mature VdAve1 and VnAve1 were cloned into pET-15b with an N-terminal His6 tag sequence (Novagen, Madison, WI, USA) (primer sequences ...
-
bioRxiv - Neuroscience 2021Quote: ... CAS # 7646-85-7 and ZnC4H6O4; CAS #557-34-6) and arsenic (NaAsO2; CAS #7784-46-5) (all from Sigma-Aldrich, St Louis, MO). The metallic compounds were either dissolved in 30% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... for 10 mins and incubated in blocking PBS solution containing 2% BSA (AppliChem, 9048-46-8) and 0.2% Triton™ X-100 (Sigma-Aldrich, 9002-93-1) for 30 mins to permeabilize cell membrane and block unspecific antigen binding ...
-
bioRxiv - Bioengineering 2023Quote: ... iSMCs were incubated for 30 mins in blocking solution containing 2% BSA (AppliChem, 9048-46-8) and 0.5% Triton™ X-100 (Sigma-Aldrich, 9002-93-1). The blocking solution was then discarded and iSMCs were incubated for 2 hrs with primary antibodies diluted in blocking solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The column was washed with KIF3A/B purification buffer and the protein was eluted in KIF3A/B purification buffer supplemented with 15 mM d-desthiobiotin (Sigma, D1411-1G). Depending on whether unlabelled or fluorescently tagged protein was needed ...
-
bioRxiv - Immunology 2022Quote: ... cholera toxin B-subunit (CTB; C9903) and heat labile enterotoxin B subunit (LTB; E9656) of Escherichia coli were purchased from Sigma (Sigma Aldrich). PhenoVue Fluor 594-WGA was obtained from PerkinElmer (Perkin Elmer Health Science Inc ...
-
bioRxiv - Immunology 2023Quote: ... were cocultured for 6 hours with autologous herpesvirus papio-immortalized B lymphoblastoid cell lines (B-LCLs) pulsed with Nef peptides (Sigma-Aldrich Japan) at 1 μM concentration or as indicated otherwise under GolgiStop (monensin ...