Labshake search
Citations for Millipore Sigma :
51 - 100 of 10000+ citations for Estrone 3 Sulfate E1S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... 5 g/L ammonium sulfate (Sigma-Aldrich, St. Louis, MO, #A4418), 2% dextrose (VWR #90000–904) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The hybridization buffer was supplemented with 5% Dextran Sulfate (Sigma #D6001). Rather than using milk to block ...
-
bioRxiv - Immunology 2020Quote: ... The polyreactivity of hybridoma-obtained IgA was tested by adding them to ELISA plates that were coated with common antigens dissolved in PBS before coating ELISA plates: Lipopolysaccharide (Sigma-Aldrich; L4391), double stranded DNA (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Transformants were plated on SDCAA-agar (1.71 g/L YNB without amino acids and ammonium sulfate [Sigma-Aldrich #Y1251], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418] ...
-
bioRxiv - Synthetic Biology 2022Quote: Animals were acclimated for 5 days before streptomycin sulfate (5 mg ml-1; Sigma-Aldrich S9137) was added to the autoclaved drinking water to decrease the number of facultative aerobic/anaerobic resident bacteria69 ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cyclin-E1 (rabbit, 1:1000, Sigma-Aldrich, cat# C4976), GFP (mouse ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Prostaglandin E1 (PGE1, 1 µM) (Sigma-Aldrich, #P5515). The DPBS PRP mixture was centrifuged at 1,000 g for 6 min without brakes ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Cell Biology 2022Quote: ... Hydroxychloroquine sulfate (Hydroxy Sulfate, Sigma-Aldrich, Cat # 379409) and Ammonium chloride (NH4Cl ...
-
bioRxiv - Immunology 2021Quote: ... Nunc-Immuno™ MicroWell™ 96 well ELISA plates (Millipore) were coated overnight with 50 μl per well of 2ug/ml RBD-His or Spike-His protein in carbonate buffer pH9 ...
-
bioRxiv - Immunology 2021Quote: ... Elisa plates were coated with 100ug/ml of OVA (Sigma) prepared in a coating buffer (Na2CO3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... ELISA 96-well plates (Nunc-Immuno™,Sigma-Aldrich®) were coated with 200 ng of purified anti-NS1 monoclonal antibody in carbonate buffer (0.05 M ...
-
bioRxiv - Microbiology 2021Quote: ... 5′5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, Taufkirchen, Germany) was added until a colour change was observed ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... murine preosteoblasts (MC3T3-E1, Sigma-Aldrich, St. Louis, MO, USA) were cultured for 7 days in minimum essential medium (α-MEM ...
-
bioRxiv - Biochemistry 2024Quote: ... an E1 ligase inhibitor from Sigma-Aldrich (catalog number N2915); and CB-5085 ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min and mounted with the hybridization buffer (10% Dextran sulfate Sigma D8906 ...
-
bioRxiv - Neuroscience 2023Quote: ... The pelleted PRP was resuspended in PBS containing prostaglandin E1 (2 μM, Absin) and ethylene diamine tetra acetic acid (EDTA) (5 mM, Sigma-Aldrich) to prevent platelet activation ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Bioengineering 2022Quote: ... the ammonium sulfate was added (Sigma ammonium sulfate A4418) to reach final concentrations of 5 ...
-
bioRxiv - Neuroscience 2020Quote: ... N-methyl-DL-aspartic acid (NMA) and 5-hydroxytryptamine creatinine sulfate (5-HT) were obtained from Sigma-Aldrich. Other drugs ...
-
bioRxiv - Microbiology 2023Quote: Nunc MaxiSorp flat bottom 96-well ELISA plates (Sigma-Aldrich, M9410) were coated with 50 ng/well of recombinant CCHFV Gn protein (Creative Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µL of an overnight culture was spotted onto BHI agar plates supplemented with 3% gelatin (Sigma). Plates were incubated at 37 °C overnight and then at 4 °C to enable better visualization of the gelatinase-positive phenotype ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... Cardiac Muscle ELISA Kit (RAB0634, Sigma-Aldrich), and 100 uL of cell culture supernatant after 24 hours of treatment with each drug at 0.5 μM ...
-
bioRxiv - Bioengineering 2020Quote: ... Kanamycin sulfate or gentamicin sulfate (Sigma-Aldrich, St. Louis, MO) was used at a concentration of 50 µg/mL or 30 µg/mL ...
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... the platelet-rich plasma is treated with 2μM Prostaglandin E1 (Sigma) and centrifuged at 800 G for 10 min ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... Background staining could be reduced by adding 5% dextran sulfate (MW > 500,000, Sigma-Aldrich) and 3% Blocking Reagent (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... 20 min after being injected with atropine sulfate (5 mg/kg ip; Sigma-Aldrich). Experienced researchers evaluated the animals’ behavioral changes until status epilepticus was reached ...
-
bioRxiv - Developmental Biology 2023Quote: ... Background staining could be reduced by adding 5% dextrane sulfate (MW > 500,000, Sigma-Aldrich) and 3% Blocking Reagent (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: Neomycin sulfate (Sigma) was dissolved in zebrafish embryo water to a stock concentration of 6 mM and then diluted to a working concentration of 50 µM (Harris et al ...
-
bioRxiv - Microbiology 2019Quote: ... ammonium sulfate (Sigma) was added at 55% w/v and incubated at room temperature for 1 hour with a magnetic stirrer ...
-
bioRxiv - Bioengineering 2022Quote: ... kanamycin sulfate (Sigma), Top 10F′ cyan cells (Thermo Fisher) ...
-
bioRxiv - Microbiology 2019Quote: ... Gal-3 levels were measured using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ELISAs were used to confirm a subset of cytokines identified in the antibody arrays (CCL2, CX3CL1, and Galectin-3 rat ELISA kits, Sigma) using apical or basal supernatants from individual Transwell® inserts from the same experiment than the multiplex array.
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 content in the supernatant of T0 and T20 samples was assessed using a Glucagon-Like Peptide-1 (GLP-1) Total ELISA KIT (96-Well Plate Cat. # EZGLP1T-36K, EZGLP1T-36BK, Millipore).
-
bioRxiv - Immunology 2022Quote: ELISA plates were coated overnight with anti-human IgG (Sigma Aldrich I5260) at 1:5 000 in PBS ...