Labshake search
Citations for Millipore Sigma :
51 - 100 of 1708 citations for Cytomegalovirus Glycoprotein B gB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Latrunculin B (Sigma, L5288) treatments were performed on TAP agar plates supplemented with 3 μM LatB and spotted in 10-fold serial dilutions.
-
bioRxiv - Cell Biology 2020Quote: Latrunculin B (Merck Millipore) was dissolved in DMSO to 1 mg/ml and stored at –20°C ...
-
bioRxiv - Cell Biology 2022Quote: ... for Hygromycin B (Sigma), cells were treated at 150 ...
-
bioRxiv - Systems Biology 2022Quote: ... and amphotericin B (Sigma) in T-75 flasks (Corning) ...
-
bioRxiv - Neuroscience 2019Quote: ... Latrunculin B (Sigma, L5288) was added to culture media from a 2.5-mM stock solution in DMSO.
-
bioRxiv - Genetics 2020Quote: ... amphotericin B (Sigma-Aldrich) was added to YNB from a stock solution of 100 µg/ml for final drug concentrations of 0.075 ...
-
bioRxiv - Cell Biology 2020Quote: ... B-actin (Sigma A1978), VDAC (CS 4867S) ...
-
bioRxiv - Cancer Biology 2021Quote: ... B-ACTlN (A5441 Sigma), CDC25B (9525 Cell Signaling) ...
-
bioRxiv - Developmental Biology 2021Quote: ... with B-mercapthoethanol (Sigma) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... Palmostatin B (EMD Millipore); ML-348 (Tocris) ...
-
bioRxiv - Genetics 2021Quote: ... or Amphotericin B (Sigma). All agar plates were incubated at 30°C for 24 to 48 h before imaging was performed.
-
bioRxiv - Microbiology 2022Quote: ... 1x amphotericin B (Sigma), 5% NaHCO3 5.5% ...
-
bioRxiv - Genetics 2022Quote: ... Hygromycin B (Sigma-Aldrich), was used to select the potentially mutated candidates.
-
bioRxiv - Plant Biology 2022Quote: ... 17-b-oestradiol (Sigma), a synthetic derivative of oestradiol ...
-
bioRxiv - Microbiology 2022Quote: ... amphotericin B (Sigma-Aldrich), micafungin (Astellas Pharma) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... CelLytic™ B (Sigma) was used as per manufacturer’s directions (approx ...
-
bioRxiv - Molecular Biology 2023Quote: ... Palmostatin B (Sigma-Aldrich), TAMRA or biotin PEG3 azide (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... amphotericin B (Sigma-Aldrich) and caspofungin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and amphotericin B (Sigma)] ...
-
bioRxiv - Genetics 2023Quote: ... b-actin (Sigma, A5441); KRAS (LSbio ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and latrunculin B (Sigma) to treat plants ...
-
bioRxiv - Microbiology 2023Quote: ... polymyxin B sulphate (Sigma), colistin sulphate (GoldBio) ...
-
bioRxiv - Biophysics 2023Quote: ... Amphotericin B (Sigma Aldrich) was used as a perforating agent dissolved in DMSO at a concentration of 0.24 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: B vitamins (Sigma-Aldrich) were dissolved in the appropriate solvent at the concentration indicated in Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Amphotericin B (Sigma) and 1% HEPES (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... or Cecropin B (Sigma). After 6h incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... Latrunculin-B (Sigma #428020) was stored at 10 mM in DMSO and used at 1 uM final ...
-
bioRxiv - Bioengineering 2024Quote: ... 5mM B-Glycerphosphate (Sigma), and 1.8 mM Monopotassium Phosphate (Sigma) ...
-
bioRxiv - Biophysics 2024Quote: Cytochalasin B (Sigma-Aldrich), used for depolymerization of actin filaments ...
-
bioRxiv - Developmental Biology 2023Quote: ... aurora B Kinase (Sigma, St ...
-
bioRxiv - Cell Biology 2024Quote: ... Cathepsin B (Millipore #219364), Cathepsin C (R&D #1071-CY) ...
-
bioRxiv - Physiology 2022Quote: ... 150 μl of 0.75mg/ml myelin oligodendrocyte glycoprotein 33 to 55 peptides (MOG35–55) mixed with Complete Freund’s Adjuvant (FS8810; Sigma-Aldrich) was injected subcutaneously into the tail base of 7 to 11-week-old female C57Bl/6 mice ...
-
bioRxiv - Molecular Biology 2021Quote: ... a sample containing 10 μg of the spike glycoprotein was buffer exchanged with 50 mM ammonium citrate buffer (pH 6.5) using a 50-kDa MWCO filter (Millipore). The resulting buffer-exchanged sample was alkylated with a 20-fold molar excess of 4-vinylpyridine in the dark for one hour at room temperature to cap free cysteine residues ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were immunized with 200 µg of myelin oligodendrocyte glycoprotein 35-55 (MOG35–55; MEVGWYRPFSRVVHLYRNGK) in incomplete Freund’s adjuvant (IFA; Sigma) supplemented with 8 mg/ml Mycobacterium tuberculosis H37Ra (Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were immunized with 200 µg of myelin oligodendrocyte glycoprotein 35-55 (MOG35–55; MEVGWYRPFSRVVHLYRNGK) in incomplete Freund’s adjuvant (IFA; Sigma) supplemented with 8 mg/mL Mycobacterium tuberculosis H37Ra (Fisher) ...
-
bioRxiv - Biochemistry 2023Quote: Purified SARS-CoV-2 spike glycoproteins were exchanged to water using Microcon Ultracel PL-10 centrifugal filter (Millipore Sigma). Glycoproteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl ...
-
bioRxiv - Genomics 2019Quote: Neutrophils (1×10^5) were spun onto cover slips using a Cytospin3 (Shandon, 74010121 GB) and flooded with Wright stain (Sigma, WS16-500ML) for 3 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... specific primers for each T-DNA line (Supplemental Table 2) were designed using SALK site (http://signal.salk.edu/tdnaprimers.2.html) and were ordered from Sigma (https://www.sigmaaldrich.com/GB/en).Ten seeds from each T-DNA mutant line were sown and seedlings were picked and transferred to pots ...
-
bioRxiv - Biochemistry 2022Quote: ... FSL-B(tri) (Function-Spacer-Lipid with blood group B trisaccharide; Sigma Aldrich) or lactosylceramide (LC ...
-
bioRxiv - Immunology 2023Quote: ... GC-B cells and follicle B cells were stained with Pna-HRP (Sigma) and anti-mouse IgD-BIOT (SouthernBiotech ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The rehydrated slides were blocked with 2% horse-serum followed by incubation with primary antibodies (Mouse anti-S-glycoprotein antibody, 1:200 dilution, Millipore, Cat # MAB5676 ...
-
bioRxiv - Neuroscience 2024Quote: ... using a subcutaneous injection of 200mg of MOG peptide (Myelin Oligodendrocyte Glycoprotein Peptide Fragment 35 to 55; from Charité) emulsified in complete Freund’s adjuvant (from Sigma-Aldrich) that contained 200mg of Mycobacterium tuberculosis H37RA (from Difco) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by Coomassie staining or western blotting with the rabbit anti-VZV gB antibody 746-868 followed by anti-rabbit-HRP (Sigma-Aldrich Chemie GmbH). For loading control ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... human recombinant MAO-A (hMAO-A) and MAO-B (hMAO-B) enzymes (Sigma-Aldrich) were diluted in 50 mM phosphate buffer (final protein amount ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...