Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for Cyclic AMP Direct ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Molecular basis of selective cytokine signaling inhibition by antibodies targeting a shared receptorbioRxiv - Immunology 2021Quote: ... The plates were washed using ELISA washing solution followed by addition of substrate (4-Nitrophenyl phosphate disodium salt hexahydrate, Sigma-Aldrich, 1 mg/ml), 150 µl/well ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.5 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate (8-Br-cAMP; Sigma-Aldrich B5386) in EGM for 6 days [30–34] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Biochemistry 2020Quote: ... The mRNA-cyclic peptide libraries were eluted with 600 µL of 0.1% DEPC (Millipore Sigma) water containing 1 mM DTT ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Neuroscience 2021Quote: ... All ELISAs were developed using ELISA TMB (Sigma-Aldrich) and absorbance read on a Bio-Tek plate reader ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Millipore-Sigma) as described previously (1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The gDNA extractions and PCR verifying integration of the fluorescent tags into the genomic loci was performed using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). PCR amplicons were run on 1 or 2% agarose gels in TBE and gels were imaged with Bio-Rad Gel ChemiDoc XRS system and Quantity One software.
-
bioRxiv - Cell Biology 2022Quote: ... ear notches were collected from mouse pups to extract genomic DNA using the RED Extract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Ear notches were incubated in the tissue preparation (25 μl/sample ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Yolk sacs from each of the dissected embryos were collected and genomic DNA preparation was done using Extract-N-Amp tissue PCR kit (Sigma-XNAT2). Placenta tissues were collected in RLT buffer and RNA was extracted using RNAeasy Mini Kit (Qiagen – 74104) ...
-
bioRxiv - Developmental Biology 2019Quote: Genomic DNA samples were prepared using tail tissues or embryonic tissues from the mice using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). Genotyping was done using REDExtract-N-Amp PCR ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Sigma-Aldrich) as previously described (41,44) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rats were screened for the presence of mutations by PCR using tail-tip DNA samples (RED extract-N-Amp Tissue PCR Kit, Sigma-Aldrich) as described previously (Rumi et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotypes were verified by PCR of tail DNA using the RedExtract-N-Amp Tissue PCR Kit (Sigma Aldrich 254-457-8).
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 or TFCP2L1 in the case of those imaged for confocal analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted from mice ear tissues (or tail for embryos) using Extraction « Extract-N-Amp PCR » kit (Sigma #XNAT2-1KT) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ear biopsies (3 week old pups) was used for PCR based genotyping using the REDExtract-N-Amp kit (Sigma-Aldrich) with the primers listed in STable5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Routine genotype analysis of mice was performed by PCR assay on DNA purified from tail biopsies (Extract N-Amp Tissue PCR kit, Sigma Aldrich). Wild-type and KO mutant alleles were distinguished using primers available on request ...
-
bioRxiv - Neuroscience 2023Quote: DNA from larval tails and juvenile and adult tail fins was extracted using the Extract-N-Amp Tissue PCR Kit (Millipore Sigma). After verifying SNP location with Sanger sequencing at Azenta Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans genomic DNA extracted from 8-10 adult worms using the Extract-N-Amp™ Tissue PCR Kit (Millipore Sigma, MA) as previously described38 then sequenced ...
-
bioRxiv - Cell Biology 2022Quote: 96-well ELISA plates were coated overnight at 4°C with anti-mouse total β1-integrin (Millipore) or anti-mouse β1-integrin ...
-
bioRxiv - Microbiology 2019Quote: ... media was supplemented with ampicillin (Amp; 100 μg/mL; Sigma, Cat#: A0166), streptomycin (Sm ...
-
bioRxiv - Neuroscience 2020Quote: ... AMP-PCP (β,γ-Methyleneadenosine 5′-triphosphate disodium salt, Millipore Sigma #M7510). ATP and non-hydrolyzable analogues were reconstituted and aliquoted in 25 mM NaHCO3.
-
bioRxiv - Neuroscience 2023Quote: ... Following the RED Extract-N-Amp Tissue PCR XNAT manufacturer’s protocol (Sigma), 2-3mm of each mouse’s tail was removed and DNA was extracted ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich). The following primers were used for genotyping ...
-
bioRxiv - Plant Biology 2024Quote: ... guanosine and adenosine monophosphate (GMP and AMP) were obtained from Sigma-Aldrich/Merck (www.sigmaaldrich.de) ...
-
bioRxiv - Bioengineering 2022Quote: CDM was generated in 12-well plates and stained with Picrosirius Red (Sirius Red/Direct Red 80, Sigma 36554) for 1 h at RT on an orbital rocker ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... commercially available ELISA kits were used to measure lactose content (Sigma-Aldrich Cat ...
-
bioRxiv - Immunology 2021Quote: ... which was analyzed by enzyme linked immunosorbent assay (ELISA) kit (Sigma, MO).
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Neuroscience 2022Quote: ... S100B ELISA kits were purchased from Millipore (EMD Millipore, St. Louis, MO) and samples were diluted 1:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasma was processed using an insulin ELISA kit (Millipore Sigma; #EZRMI-13K) following manufacturer’s instructions in duplicate ...
-
bioRxiv - Physiology 2023Quote: ... we used the ApopTag Fluorescein Direct In Situ Apoptosis Detection Kit (S7160, Millipore Sigma) as previously described [22] ...
-
bioRxiv - Biochemistry 2024Quote: ... blood plasma was collected at 9 am and ELISA kits were used following manufacturer’s instructions (Leptin: Crystal Chem, 90030; GLP-1: Sigma, EZGLP1T-36K ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 μM of the PKA activator 8-Bromoadenosine 3’,5’-cyclic monophosphate (Sigma, dissolved in water) and without FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... to activate the p53 pathway or Cyclic Pifithrin-α hydrobromide (PF-α; Sigma #P4236; 20 µM) to inhibit the p53 pathway ...
-
bioRxiv - Systems Biology 2024Quote: ... 8-Br cAMP (8-Bromoadenosine 3′,5′-cyclic monophosphate, final conc. 500 µM; Sigma B6386-100mg). In addition to stimulation for decidualization ...
-
bioRxiv - Cell Biology 2021Quote: DNA extraction from mouse tail clips obtained at 7-10 days of age was performed using REDExtract-N-Amp™ Tissue PCR Kit (Cat#R4775, Sigma Aldrich) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... for ELISA (Sigma) was added to visualize the reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... and Direct Red (Sigma, 365548). Slides were then washed in 0.5% glacial acetic acid (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... ELISAs of cells harvested from tryptone plates were treated with 100 Kunitz units/mL DNaseI (D5025, Sigma Aldrich) for 1 hr statically at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... AMP-PNP (β,γ-imidoadenosine 5’-triphosphate lithium salt hydrate, Millipore Sigma #10102547001), AMP-CPP (α,β-methyleneadenosine 5’-triphosphate lithium salt ...
-
Orange is the new white: taxonomic revision of Antarctic Tritonia species (Gastropoda: Nudibranchia)bioRxiv - Zoology 2020Quote: ... 3.3 μL REDExtract-N-Amp PCR ReadyMix (Sigma Aldrich, St. Louis, MO, USA), 0.3 μL of each primer ...
-
bioRxiv - Microbiology 2022Quote: ... AMP stock solutions (100 mg/ml) were prepared by diluting ampicillin (Sigma-A0166) directly in 0.5% w/v arabinose LB.
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...