Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Cyclic AMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... elegans genomic DNA extracted from 8-10 adult worms using the Extract-N-Amp™ Tissue PCR Kit (Millipore Sigma, MA) as previously described38 then sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... Following 3X 5 minutes washes in TBS + 0.1% Tween the blot was incubated with Immobilon Western Chemiluminescent HRP Substrate (Millipore) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used for detection ...
-
bioRxiv - Genomics 2020Quote: ... and Chemiluminescent HRP Substrate (Millipore, WBKLS0500) were used for the detection ...
-
bioRxiv - Microbiology 2022Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... Immobilon Western Chemiluminescent HRP substrate (Millipore) was then applied to the membranes for protein band visualization by chemiluminescence ...
-
bioRxiv - Cell Biology 2022Quote: ... chemiluminescent Luminata™ Crescendo procedure (Millipore) or SuperSignal West Pico Chemiluminescent substrate (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used for protein detection.
-
bioRxiv - Microbiology 2023Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... The plate was washed with 5% Hellmanex Ⅲ (Sigma) overnight and 5 M NaOH for three times ...
-
bioRxiv - Cell Biology 2022Quote: 96-well ELISA plates were coated overnight at 4°C with anti-mouse total β1-integrin (Millipore) or anti-mouse β1-integrin ...
-
bioRxiv - Microbiology 2020Quote: ... The ELISA plates were washed five times with wash buffer (1 X PBS/0.05% Tween 20 (Sigma)) and blocked with 100 µl/well 5% FBS (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... media was supplemented with ampicillin (Amp; 100 μg/mL; Sigma, Cat#: A0166), streptomycin (Sm ...
-
bioRxiv - Neuroscience 2023Quote: ... Following the RED Extract-N-Amp Tissue PCR XNAT manufacturer’s protocol (Sigma), 2-3mm of each mouse’s tail was removed and DNA was extracted ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich). The following primers were used for genotyping ...
-
bioRxiv - Plant Biology 2024Quote: ... guanosine and adenosine monophosphate (GMP and AMP) were obtained from Sigma-Aldrich/Merck (www.sigmaaldrich.de) ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.15 M 2-amino-2-methyl-1-propanol (AMP) (A65182, Sigma-Aldrich) in UPW ...
-
bioRxiv - Bioengineering 2022Quote: CDM was generated in 12-well plates and stained with Picrosirius Red (Sirius Red/Direct Red 80, Sigma 36554) for 1 h at RT on an orbital rocker ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... commercially available ELISA kits were used to measure lactose content (Sigma-Aldrich Cat ...
-
bioRxiv - Immunology 2021Quote: ... which was analyzed by enzyme linked immunosorbent assay (ELISA) kit (Sigma, MO).
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Neuroscience 2022Quote: ... S100B ELISA kits were purchased from Millipore (EMD Millipore, St. Louis, MO) and samples were diluted 1:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasma was processed using an insulin ELISA kit (Millipore Sigma; #EZRMI-13K) following manufacturer’s instructions in duplicate ...
-
bioRxiv - Physiology 2023Quote: ... we used the ApopTag Fluorescein Direct In Situ Apoptosis Detection Kit (S7160, Millipore Sigma) as previously described [22] ...
-
bioRxiv - Cell Biology 2022Quote: ... Chemiluminescence was visualized employing HRP-conjugated secondary antibodies and chemiluminescent substrate (Immobilon Western Chemiluminescent HRP Substrate, Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... after a chemiluminescent reaction (Immobilon® Western Chemiluminescent HRP Substrate, Cat# WBKLS0100, EMB Millipore, Burlington, MA, USA). Total protein normalization was applied to compare levels of CREB1 and AA-NAT among ZTs ...
-
bioRxiv - Neuroscience 2022Quote: ... sandwich ELISA of tau-5 coating antibody (20 µg/ml; Millipore Cat# 577801-100UG RRID: AB_212534) with either biotin-conjugated HT-7 (for human tau ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1% Tween 20 (pH=2.2) for 5 min followed by staining with direct blue 71 (DB71, Sigma) as per the manufacturer protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the signals were visualized using the Immobilon Western Chemiluminescent HRP Substrate Kit (WBKLS0500, Millipore, Billerica, USA).
-
bioRxiv - Immunology 2021Quote: ... dibutyryl cyclic adenosine monophosphate (db-cAMP) and 3-isobutyl-1-methyxanthine (IBMX) were purchased from Sigma. Complete RMPI consisted of RPMI 1640 (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... to activate the p53 pathway or Cyclic Pifithrin-α hydrobromide (PF-α; Sigma #P4236; 20 µM) to inhibit the p53 pathway ...
-
bioRxiv - Cell Biology 2021Quote: DNA extraction from mouse tail clips obtained at 7-10 days of age was performed using REDExtract-N-Amp™ Tissue PCR Kit (Cat#R4775, Sigma Aldrich) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... for ELISA (Sigma) was added to visualize the reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... and Direct Red (Sigma, 365548). Slides were then washed in 0.5% glacial acetic acid (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... ELISAs of cells harvested from tryptone plates were treated with 100 Kunitz units/mL DNaseI (D5025, Sigma Aldrich) for 1 hr statically at 37 °C ...
-
Orange is the new white: taxonomic revision of Antarctic Tritonia species (Gastropoda: Nudibranchia)bioRxiv - Zoology 2020Quote: ... 3.3 μL REDExtract-N-Amp PCR ReadyMix (Sigma Aldrich, St. Louis, MO, USA), 0.3 μL of each primer ...
-
bioRxiv - Microbiology 2022Quote: ... AMP stock solutions (100 mg/ml) were prepared by diluting ampicillin (Sigma-A0166) directly in 0.5% w/v arabinose LB.
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Microbiology 2021Quote: ... For visualization chemiluminescent substrate HRP (Merck Millipore) was used and the blots exposed on X-ray film (Advansta).
-
bioRxiv - Neuroscience 2022Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore) and ChemiDoc XRS+ Imaging System (Biorad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Blots were incubated with chemiluminescent reagents (Millipore) and exposed to film (GE).
-
bioRxiv - Genomics 2019Quote: ... and visualized with Immobilon chemiluminescent reagent (Millipore) using a Chemidoc Touch imaging system (Bio-Rad).
-
bioRxiv - Molecular Biology 2020Quote: ... and Immobilon Western HRP Chemiluminescent substrate (Millipore) before imaging on a Chemidoc Touch (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... Immobilon Western Chemiluminescent HRP substrate (Millipore, UK) was used for visualization.
-
bioRxiv - Cancer Biology 2023Quote: ... or Immobilon Western chemiluminescent substrate (Millipore Sigma). Images were captured and analyzed using ImageLab (Biorad ...
-
bioRxiv - Bioengineering 2023Quote: ... Immobilon Western Chemiluminescent HRP Substrate (Millipore Sigma) was used to visualize bands with the Genesys G:Box imaging system 3 (Syngene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immobilon Western chemiluminescent HRP substrate (#WBKLS0500, Millipore), or Pierce ECL Western blotting substrate (#32106 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immobilon Western Chemiluminescent HRP substrate (Millipore, MA) was used for detection.