Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Cow Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Goat and cow whey protein were purchased from Sigma (USA). The recombined lactoferrin (rLF) ...
-
bioRxiv - Microbiology 2020Quote: ... Goat and cow whey proteins were purchased from Sigma (USA). Heparin was purchased from Sigma (USA) ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 10 % Bovine Cow Serum (BCS; Sigma 12133C) and 1 % Penicillin/Streptomycin (Gibco ...
-
bioRxiv - Physiology 2022Quote: siRNA Universal Negative Control (SIC001) and si-PCMT1 (SASI_Hs01_00229688) were from Sigma-Aldrich and transfected using Lipofectamine RNAiMAX Transfection Reagent (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... pLKO-PCMT1 construct (TRCN0000036403) and Non-Target shRNA Control (SHC016) were from Sigma-Aldrich. Lentiviral pLKO constructs were transfected with packaging and envelope plasmids to HEK293T cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Immunology 2024Quote: ... 96-well ELISA plates were first coated overnight with poly-L-lysine (Sigma), then overnight with DNA from calf thymus (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... Cardiac Muscle ELISA Kit (RAB0634, Sigma-Aldrich), and 100 uL of cell culture supernatant after 24 hours of treatment with each drug at 0.5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... C-reactive protein (CRP) was measured by an ELISA kit (cat. number CYT294, Millipore Sigma, Saint Louis, MO) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Bioengineering 2020Quote: ... human VEGF ELISA kit (RAB0507-1KT, Sigma Aldrich), glutaraldehyde solution (340855 ...
-
bioRxiv - Cell Biology 2021Quote: ... ALP activity was determined by ELISA kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Pathology 2023Quote: ... adiponectin levels were measured by enzyme-linked immunosorbent assays (Human Chemerin ELISA kit, Biovendor, Brno, Czech Republic; Human Resistin ELISA kit, Millipore Sigma; Human Total Adiponectin/Acrp30 Quantikine ELISA Kit ...
-
bioRxiv - Physiology 2021Quote: We used ELISA kits to detect the concentrations of inflammatory mediators such as TNF-α (KIT ELISA TNF-a-RAB0477-1KT, Sigma-Aldrich) and IL-6 (KIT ELISA IL-6-RAB0308-1KT ...
-
bioRxiv - Molecular Biology 2021Quote: ... The levels of Aβ40 and Aβ42 were quantified by sandwich ELISA using Aβ40 and Aβ42 EZbrain ELISA kit (EMD Millipore) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: FGF21 ELISA was performed following the manufacturer’s guidelines (FGF21 ELISA kit, Millipore Sigma catalogue number-EZRMFGF21-26K).
-
bioRxiv - Physiology 2022Quote: ... total adiponectin by ELISA kit EZMADP-60K (EMD Millipore), high molecular weight (HMW ...
-
bioRxiv - Physiology 2020Quote: ... Insulin was measured in plasma by ELISA kit (Millipore). For IP-GTT (2 g/kg ...
-
bioRxiv - Biochemistry 2023Quote: ... previously quantified via a human ANGPTL4 ELISA kit (Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... The Anti-human IGFBP2 ELISA kit (Sigma, #RAB0233-1KT) was used to quantify IGFBP2 protein in the supernatants according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: ... mouse GLP-1 ELISA kit (EZGLP1T) from Sigma-Aldrich; mouse GDF15 ELISA kit (DY6385 ...
-
bioRxiv - Cell Biology 2019Quote: ... Human c- peptide ELISA kit (cat # EZHCP-20K, Millipore MA), Human Insulin ELISA kit (cat # ELH- Insulin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A commercial kit (Rat RAGE/AGER ELISA, #RAB0009, Sigma-Aldrich) was used to quantify RAGE levels ...
-
bioRxiv - Microbiology 2024Quote: ... and the Bovine IFN-alpha ELISA Kit (Sigma-Aldrich, RAB1012) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Media aliquots were frozen and subjected to ENG ELISA analysis with the Human Endoglin ELISA kit (Sigma-Aldrich RAB0171) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Bovine lenses were extracted from fresh cow eyes (Light Hill Meats, Lynnville, TN) and incubated in M199 medium (Sigma, St. Louis, MO) that contained 1mg/ml Texas Red-dextran (10,000 MW ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: HMGB1 levels were measured using a commercial kit (HMGB1 ELISA kit A76696, Sigma-Aldrich). The assay was performed as described in the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Protein expression was induced with 0.1% L-arabinose (Sigma-Aldrich). Expression took place for 16 h at 15°C and 220 rpm ...
-
bioRxiv - Immunology 2021Quote: ... Protein expression was induced by addition of L-(+)-arabinose (Sigma) to a final concentration of 0.02% (w/v ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Protein expression was induced by adding L-arabinose (Sigma-Aldrich) to a final concentration of 0.2% when the cultures reached a OD600 of 0.4 ...
-
bioRxiv - Physiology 2020Quote: ... and GLP-1 ELISA kit Active (EGLP-35K, Millipore, MA, USA), respectively.
-
bioRxiv - Physiology 2021Quote: ... and IL-6 (KIT ELISA IL-6-RAB0308-1KT, Sigma-Aldrich) in BALF following the kit instructions ...
-
bioRxiv - Neuroscience 2023Quote: The S100B ELISA Kit (#EZHS100B-33K; EMD Millipore, Billerica, MA, US) and Human MMP-14 ELISA Kit (#ab197747 ...
-
bioRxiv - Microbiology 2023Quote: ... was frozen for ELISA analysis (IL-1β kit (Sigma-Aldrich RAB1108). MMP9 ELISA ...
-
bioRxiv - Microbiology 2022Quote: ... Biotinylated proteins were captured in ELISA plates precoated with 5 μg/ml of avidin (Sigma) in Na2CO3-NaHCO3 buffer (pH 9.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... All ELISAs were developed using ELISA TMB (Sigma-Aldrich) and absorbance read on a Bio-Tek plate reader ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2022Quote: ... commercially available ELISA kits were used to measure lactose content (Sigma-Aldrich Cat ...
-
bioRxiv - Immunology 2021Quote: ... which was analyzed by enzyme linked immunosorbent assay (ELISA) kit (Sigma, MO).
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Neuroscience 2022Quote: ... S100B ELISA kits were purchased from Millipore (EMD Millipore, St. Louis, MO) and samples were diluted 1:1 ...