Labshake search
Citations for Millipore Sigma :
251 - 300 of 8323 citations for Cathepsin B Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-myc mAb (1:500 dilution, Sigma, M5546), Rabbit anti-53BP1 polyclonal Ab (1:3000 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought (SI Appendix ...
-
bioRxiv - Molecular Biology 2023Quote: ... or mAb mouse α-puromycin (1:5’000, Sigma MABE343) diluted in blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: ... PSD-95 mouse mAb (1:200, MAB1596, Millipore Sigma), EEA1 mouse mAb (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... 30μg monoclonal antibody (mAb) or ChromoPure IgG control (Sigma) was added to each IP tube and mixed by rotator for 4hr at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... and anti-Flag mouse mAb (M2 antibody, Sigma, F3165) antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... or rat anti-AGO2 mAb (Millipore MABE253 clone, 11A9) diluted in 2% bovine serum albumin in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-GluA2 (1:500, EMB Millipore MAB 397) and subsequently with corresponding secondaries at 37°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-GFAP (clone GA5, 1:1000; #MAB 3402, Millipore), anti-Olig2 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed with buffer and recombinant Tau protein (Sigma recombinant Tau protein #T0576) and ATP (Sigma #A1852 ...
-
bioRxiv - Biochemistry 2022Quote: ... FSL-B(tri) (Function-Spacer-Lipid with blood group B trisaccharide; Sigma Aldrich) or lactosylceramide (LC ...
-
bioRxiv - Immunology 2023Quote: ... GC-B cells and follicle B cells were stained with Pna-HRP (Sigma) and anti-mouse IgD-BIOT (SouthernBiotech ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... blocked in 10% NGS in PBST at 4°C for 3 hr and immunohistochemistry steps were carried out by incubating the samples with primary anti-pH3 antibody (diluted 1:300 in blocking buffer, REF 05-817R, clone 63-1C-8, recombinant rabbit monoclonal antibody, Millipore, USA) for overnight at 4°C as previously described [37–39] ...
-
bioRxiv - Zoology 2020Quote: ... Each lysate was confirmed to express the appropriate recombinant protein at the expected size using an anti-V5 antibody produced in rabbit (Sigma V8137). Isoform specificity was tested via immunoblotting all cell lysates (empty vector control ...
-
bioRxiv - Cell Biology 2021Quote: Primary antibodies used are as follows: Anti-poly-ADP-ribose binding reagent/ PAR reagent (recombinant protein fused to rabbit Fc tag; Millipore, MABE1031), Rabbit monoclonal anti-Poly/Mono-ADP Ribose (anti-PAR/MAR ...
-
bioRxiv - Neuroscience 2020Quote: Free floating mouse brain sections were incubated with 300 nanograms of active human cathepsin-S (SRP0292, Sigma-Aldrich, St. Louis, MO), in activation buffer containing 1.8 mM DTT ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1μM recombinant human insulin (Sigma). Organoids were collected from the wells on day 14 and transferred to 10cm dishes at roughly 20 organoids per dish ...
-
bioRxiv - Physiology 2022Quote: ... 500μg/ml human recombinant albumin (Sigma), 213μg/ml L-ascorbic acid (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... and recombinant chondriotinase ABC (Sigma, C3667) was treated at 25 mU/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Recombinant active AMPK (Millipore, 14-840) was added and incubated for 30 min at 30°C ...
-
bioRxiv - Immunology 2020Quote: ... human recombinant TNF (H8916, Sigma-Aldrich) or chemical inhibitors (SB203580 from Selleck ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant IFNα was purchased from Sigma (Interferon-αA/D human Cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Recombinant mouse LIF (Sigma, #ESG1107). Additionally ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant purified Angiotensin II (Sigma – A9525) at 1 μM with 2-fold serial dilutions ...
-
bioRxiv - Immunology 2022Quote: ... recombinant complement component C3 (Millipore Sigma), recombinant CD4 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... recombinant leukemia inhibitory factor (SRP3316; Sigma), growth hormone (869008 ...
-
bioRxiv - Neuroscience 2023Quote: ... and/or recombinant Fibronectin (Sigma-Aldrich) were applied as described using a range of concentrations (μg/ml).
-
bioRxiv - Biophysics 2023Quote: ... superoxide dismutase (bovine SOD, recombinant, Sigma) was added from a ≥50,000 U/mL stock prepared in assay buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: BG4 recombinant antibody (Sigma Aldrich MABE917)- ChIP
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 100 mIU/ml recombinant hCG (Sigma), and 10 mg/ml of human serum albumin (Sage) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000U/ml ESGro recombinant LIF (Millipore), 1uM PD0325901 (R&D Systems) ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...