Labshake search
Citations for Millipore Sigma :
351 - 400 of 418 citations for CYB5A siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The siRNA-lipid complexes were mixed 1:2 (volumes) in 30% pluronic F-127 gel (Sigma-Aldrich). 15 µl mixture was topically applied on the wounds immediately after injury and 3 days later ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 20nM of a mix of 2 control siRNAs (#SIC001 and #SIC002, Sigma-Aldrich), or 20nm of a mix of 2 siRNAs targeting Esrra (siEsrra-1 ...
-
bioRxiv - Cell Biology 2023Quote: SV589/NAGTI-GFP cells grown on glass coverslips were transfected with siRNA Universal Negative Control #1 (Sigma) or duplexes targeting GM130 or FXR1 (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... either with 25 nM sipool control (MISSION® siRNA Universal Negative Control #1 and #2, Sigma Aldrich) or with 25 nM of sipool for LISR (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 20 nM select siRNA for either c-Jun (si-c-Jun; Sigma-Aldrich), p53 (si-p53 ...
-
bioRxiv - Cell Biology 2023Quote: ... human Ndc80/Hec1 siRNA (sequence antisense: 5’-GAAUUGCAGCAGACUAUUA-3’, dTdT overhangs, Sigma-Aldrich, St. Louis, MO, USA), human KIF4A siRNA (sc-60888 ...
-
bioRxiv - Cancer Biology 2023Quote: All siRNAs used in the study were part of the MISSION® esiRNA (Sigma-Aldrich, Euphoria Biotech) library (Supplementary Table 5 ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: The small interfering RNAs (siRNAs) against Rattus norvegicus GR (SASI_Rn01_00092098, SASI_Rn01_00092099) and scramble control (SIC001) were obtained from Sigma-Aldrich. Lipofectamine 2000 Kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2020Quote: HDDC3 was transiently silenced in HeLa cells by transfecting MISSION predesigned siRNAs (SASI_Hs01_00101056 and SASI_Hs01_00101057, Sigma-Aldrich Co.) duplexed with Lipofectamine RNAiMAX (Life Technologies Corp. ...
-
bioRxiv - Genetics 2021Quote: ... Custom synthetic siRNA duplexes siMasc_II and siMasc_VII (see S3 Table for sequence details) were obtained from Sigma-Aldrich. The siRNA duplexes were dissolved in 100 µL nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... and the sequences of the siRNAs targeting DDX42 were siDDX42-1: 5’-CAGAAUGCCUGGUUUCGGA-3’ (SASI_Hs01_00119846, Sigma-Aldrich®), siDDX42-2 ...
-
bioRxiv - Systems Biology 2020Quote: ... Negative controls consisted of transfection with the MISSION siRNA Universal Negative Control (Sigma-Aldrich; Cat#SIC001; Lot#WDAA1199). Predesigned MISSION siRNA’s targeting individual genes were ordered from Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... universal MISSION® siRNA Universal Negative Control #1 (cat. SIC001) and #2 (cat. SIC002) were from Millipore Sigma. We used the DharmaFECT 4 Transfection Reagent (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The following siRNA molecules used against the coding sequence of Pol κ (Polκ) (5’CCAAUAGACAAGCUGUGAU3’ from Sigma-Aldrich), the 3’UTR of Pol κ (Polκ3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells grown for 48 hours following siRNA transfection were supplemented with 100 µg/ml CHX (Sigma, cat# C4859) or an equal volume of DMSO (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... small interfering RNAs (siRNAs) and scrambled controls (scRNAs) designed for astikine and hemocytin were synthesized by Millipore Sigma with UU overhangs ...
-
bioRxiv - Cell Biology 2023Quote: ... Desalted siRNA duplexes modified by double-deoxythymidine overhangs at 3’-ends of both strands were synthesized by Sigma. The AllStar siRNA (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: Adult female worms were incubated with 5 μM of 5’ cy3-labeled Bma-lad-2 siRNA 1 (Sigma Aldrich) for 24 hrs to evaluate uptake of siRNA into intestinal tract epithelial cells ...
-
bioRxiv - Cell Biology 2021Quote: ... 6μl of 10μM siRNAs targeting human KLC1 or KLC2 were mixed with 12μl HiPerFect in high-glucose DMEM medium (Sigma-Aldrich) and combined with 1×105 cells per well of a 6-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... and p53 intron-9 (gaugcuacuugacuuacga) (Marcel, Fernandes et al. 2014) and total p53 (gagguuggcucugacugua, siRNA ID: SASI_Hs02_00302766) were purchased from SIGMA-ALDRICH. 700,000 to 1 million cells were plated in 100mm tissue culture plates overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... (2×103-5×103) siRNA reverse transfected endothelial cells (24h or 48h post transfection) were seeded to fibronectin (Sigma)-coated E-plates (growth ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA targeting the LIM domain of EPLIN (# SASI_Hs02_00326071; TATTGTAAGCCTCACTTCAA) and a scrambled control siRNA (#SIC001) were obtained from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl plasmid vectors (2 μg) and/or siRNA oligos (0.1 nmol) containing 0.05% fast green FCF (Sigma-Aldrich) were injected into each DRG ...
-
bioRxiv - Cancer Biology 2023Quote: ... Scramble siRNA was utilized as a negative control in each experiment at the same concentration (Sigma-Aldrich cat. #: SIC001). This siRNA mixture was added to 1.5 mL fresh complete medium on the cells ...
-
bioRxiv - Genetics 2023Quote: The siRNA screen was performed in 384-well round bottom plates coated with poly-D-lysine (Sigma-Aldrich #P7886). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were seeded at 200,000 cells per well and immediately transfected with 30 picomoles of control siRNA (Sigma SIC001), or 15 picomoles each of two previously-validated (Otomo et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transient transfection with mutant MLH1 constructs (purchased from TWIST Biosciences) and siRNA against CDK4/6 (purchased from Sigma-Aldrich) was conducted using JetPrime PolyPlus transfection reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... of rat embryonic fibroblasts (REF) cells were transferred (seven days post initial siRNA tranfection) onto REF feeder layer inactivated with mitomycin C (Sigma) in replicates of four in a 12 well plate and maintained in ESC media (DMEM/F12 supplemented with 20% knockout serum replacement (KSR ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A total of 2.5 μg of plasmid DNA or 80 ng of siRNA (siWIPI3, EMU081491 or siWIPI4, EMU007321 or siControl, SIC001 all Sigma) was used per transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... X-tremeGENE 9 DNA Transfection Reagent and X-tremeGENE siRNA Transfection Reagents were purchased from Sigma-Aldrich (St. Louis, MO). FG4592 (#HY-13426 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transfection was carried out in a total of 15,000 ELT3-V cells transfected with SCR and Etv2 siRNA for 24 hours using X-tremeGENE HP DNA transfection reagent (Sigma). Cells were transfected with 10 ng of pRL_CMV vector (internal control ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Cell Biology 2020Quote: Silencing of MASTL and TSC2 was performed using pLKO.1 lentiviral plasmids encoding specific siRNA (ON-TARGET SMARTpool, Dharmacon) or shRNA sequences (Sigma), as previously described 59 ...
-
bioRxiv - Cell Biology 2023Quote: ... Specific depletion was controlled with an equivalent amount of non-targeting siRNA (D-001810-01-05, onTarget Plus, Dharmacon) or GFP esiRNA (EHUEGFP, Sigma). siRNA-induced depletion of vimentin was obtained with 20 nM of siRNAs from Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... per 2.7 x 105 hiPSC-CMs 5 days post plating using Mission® siRNA Transfection Reagent (Cat. S1452, Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: PFKFB3 depletion was carried out in HEK293 cells using siRNAs (80 nM; transfected twice on consecutive days) from SIGMA (SASI_Hs01_00065120). The cells were treated with control or specific siRNA and lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Tspan12 siRNA duplexes (#1: 5’-GCUUAUCUUUGCCUUCUCCTT-3’ and 5’-GGAGAAGGCAAAGAUAAGCTT-3’; #2: 5’-AUGAGGGACUACCUAAAUATT-3’ and 5’-UAUUUAGGUAGUCCCUCAUTT-3’) (Sigma) using Lipofectamine RNAiMax (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... either 8x103 cells (for immunostaining) or 30x103 cells (for qPCR) were plated in 24-well plates with medium containing siRNAs (Sigma) and HiPerFect transfection reagent (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: Gene expression of endogenous CENP-C was inhibited using a single siRNA (target sequence: 5’-GGAUCAUCUCAGAAUAGAA-3’ obtained from Sigma-Aldrich), which targets the coding region of CENP-C mRNA ...
-
bioRxiv - Microbiology 2019Quote: ... Huh7 cells seeded at 7.5×106 in a 10 cm cell culture dish were transfected 24 hours later with 100 nM of the indicated siRNA duplex or 2 μg of 3xFLAG-BAP (Bacterial Alkaline Phosphatase; Sigma #C7472), HuR-Flag (GenScript #OHu23723D) ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: Primary astrocytes were transfected with either 50 μmol of a HMG20A small interfering (si)RNA or a luciferase siRNA (Sigma-Aldrich) as previously described [17] ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... CD58 knock-down was assessed by comparing transcript levels between cultures transfected with one MISSION siRNA Universal Negative control (Sigma aldrich) and CD58 siRNA-transfected cultures using RT-PCR ...
-
bioRxiv - Cell Biology 2020Quote: Characterization of siRNA targeting BPIFB3 was described previously and CONsi and BPIFB3si werw purchased from Sigma (Delorme-Axford et al., 2014). ON-TARGETplus SMARTpool siRNAs targeting ARFGAP1 and TMED9 were purchased from Dharmacon ...
-
bioRxiv - Neuroscience 2021Quote: ... mediated knockdown of Zfp804a (the rat homolog of ZNF804A) in rat primary cortical neurons was conducted using the N-Ter Nanoparticle siRNA Transfection System (Sigma: N2788) at DIV15 per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Depletion of endogenous Spindly was achieved through reverse transfection with 50 nM Spindly siRNA (5′-GAAAGGGUCUCAAACUGAA-3′ obtained from Sigma-Aldrich) for 48 hours with RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: CFs subjected to transfection with NT or anti-Col 6 siRNA were incubated for 10 min on ice in RIPA Buffer (Sigma-Aldrich). Samples were then centrifuged at 13,000xg for 15 minutes and supernatants were collected ...
-
bioRxiv - Cell Biology 2022Quote: Transient knockdown of human ANXA1 or LGN in MCF-10A cells was achieved by transfection of MISSION® Predesigned siRNAs from Sigma. The following products were used ...