Labshake search
Citations for Millipore Sigma :
51 - 100 of 10000+ citations for CCL24 Eotaxin 2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... sequences flanking the Human TRR-TCT3-2 gene are in italics) was ordered from Sigma Aldrich. Non-template and template strands were annealed in H2O followed by heating to 95 ⁰C for 5 min before cooling down to 20 ⁰C at a rate of 1 ⁰C/min ...
-
bioRxiv - Biochemistry 2021Quote: Human IgM purified from human serum (Sigma) was digested with trypsin ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10% FCS and human fibroblast growth factor-2 (5 ng/mL, Sigma-Aldrich, St Louis, MO, USA) at 37 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... Recombinant human BMP-2 (Pfizer) was reconstituted in a 0.1% solution of rat serum albumin (Sigma-Aldrich) and 4 mM HCl and mixed with alginate ...
-
bioRxiv - Immunology 2020Quote: ... A 6X 2-fold serial dilution (8000-250 μg/mL) of human hemoglobin (Sigma, St. Louis, MO) was prepared ...
-
bioRxiv - Microbiology 2021Quote: ... of human DDX21 isoform 1 (NM_004728.4) and isoform 2 (NM_001256910.1) into plasmid p3XFLAG-CMV-14 (Sigma-Aldrich), respectively ...
-
bioRxiv - Genomics 2020Quote: ... the cells were spun down and moved to “Phase 2” IMDM media containing 5% human serum (Sigma), 330µg/mL transferrin ...
-
bioRxiv - Neuroscience 2022Quote: ... C3 and C1 were analyzed with HCMP2MAG-19K-02 Human Complement Magnetic Bead Panel 2 (Merck Millipore). Supernatants from non-stimulated CTL and L2-PD astrocytes cultured for 14 days were collected and stored at −80°C for long storage ...
-
bioRxiv - Systems Biology 2023Quote: ... CD8+ T-cell cultures were supplemented with 120 IU/ml human recombinant IL-2 (Sigma Aldrich, USA). T-cells were aliquoted into five samples with 1.5 x 106 cells in each condition to obtain cells at five different time points (6 hours ...
-
bioRxiv - Physiology 2023Quote: ... Immortalized human LX-2 cells (MilliporeSigma, Burlington, VT, USA) were cultured in phenol-free DMEM (Sigma-Aldrich) containing 2% FBS (Gibco ...
-
bioRxiv - Pathology 2023Quote: ... or 2 mg of human IgG isotype (n = 4) (I4506-100MG, Millipore-Sigma, Saint Louis, MO,USA) were injected subconjunctivally in the upper eyelid of eyes immediately after the post-alkali exposure irrigation ...
-
bioRxiv - Pathology 2023Quote: ... or 2 mg of human IgG isotype (n = 4) (I4506-100MG, Millipore-Sigma, Saint Louis, MO,USA) were injected subconjunctivally in the upper eyelid of eyes immediately after the post-alkali exposure irrigation ...
-
bioRxiv - Microbiology 2021Quote: ... Putative ligand proteins (elastin from human skin, fibrinogen from human plasma, laminin from human placenta, fibronectin from human plasma) (all from Sigma) were resuspended in carbonate-bicarbonate buffer (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... or human (1:20000; anti-human IgG; Sigma) for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNAs stably integrated in mouse and human cells were selected with 10 and 2 μg/ml puromycin (Sigma), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... Human HeLa cells (ATCC CCL-2) were maintained in Minimum Essential Medium Eagle (MEM) (Sigma-Aldrich, Taufkirchen, Germany), 7% FBS and 1% MEM non-essential amino acid solution ...
-
bioRxiv - Physiology 2021Quote: ... C2C12 myotubes were cultured in the differentiation medium containing 2 or 200 nM human insulin (Cat.# I9278, Sigma) for 16 hours prior to reaching day 10 (Fig.1A) ...
-
bioRxiv - Immunology 2020Quote: ... Transduced CD8+ T cells were expanded in the presence of 10 U/ml recombinant human IL-2 (Sigma) Human CD8+ T cells were purified from donor PBMCs (Cambridge Bioscience or NHSBT ...
-
bioRxiv - Cell Biology 2023Quote: 2 μg GST-tagged NuSAP point mutants were incubated with 50 ng human recombinant Aurora A (Sigma-Aldrich) in a water bath at 30°C for 30 min in kinase buffer (50 mM Tris-HCl ...
-
bioRxiv - Immunology 2022Quote: ... CD8+ T cells were expanded in the presence of 10 U/mL recombinant human IL-2 (11147528001, Sigma). Human CD8+ T cells were purified from donor PBMCs (NHSBT or Karolinska Hospital ...
-
bioRxiv - Genomics 2023Quote: ... HUDEP-2 were maintained in Iscove’s modified Dulbecco’s medium (IMDM) supplemented with 330 μg/mL human holo-transferrin (Sigma), 10 μg/mL recombinant human insulin (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... containing 2% (vol/vol) of heat inactivated (HI, for 1h at 56°C) human AB serum (hABS) (Sigma, #H3667). After extensive washings with DPBS (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... an additional blocking step was performed by incubating cells with 2 mg/ml γ-globulins from human blood (Sigma) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μg/mL rice-derived recombinant human albumin and 213 μg/mL L-ascorbic acid 2-phosphate (Sigma-Aldrich). After 24 hours of CHIR99021 stimulation ...
-
bioRxiv - Neuroscience 2019Quote: ... pH = 7.6) containing 0.01% Triton X-100 (TBS-T) and then blocked with 2% human serum albumin (HSA; Sigma-Aldrich) and 10% NGS in TBS-T for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... The albumin analyte was selected and measured using MILLIPLEX MAP Human Kidney Injury Magnetic Bead Panel 2 (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Human serum albumin (fraction V) 98% and 5,5’-dithiobis-2-nitrobenzoic acid (DTNB) were purchased from Sigma Aldrich (USA) and used without any prior purification ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse primary cortical cultures were then treated with 0.5 μg/ml human recombinant tissue inhibitor of metalloproteinase-2 (TIMP2, Sigma) for one biological replicate or 10 μM BB94 for two biological replicates ...
-
bioRxiv - Immunology 2024Quote: ... which after solidification were overlayed by basal medium containing Advanced DMEM/F12 + 1:100 Glutamax + 10 mM HEPES + 1.25 mM N-AcetylCystein + 1:50 B-27 Supplement + 1:100 N-2 Supplement + 50 ng/ml human EGF + 1:500 Primocin + 0.002% Heparin (Sigma), supplemented with additional factors as described in the main text ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Recombinant human MMP-2 (R&D) and MMP-9 (R&D) were activated using p-aminophenylmercuric acetate (APMA, Sigma) in MMP assay buffer (50 mM Tris (Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... or human liver microsomes (HLMs) (male human pooled, Sigma-Aldrich), respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human haemoglobin (Sigma) was used for creation of standard curve.
-
bioRxiv - Microbiology 2021Quote: ... human insulin (Sigma), 10’000 units/ml of penicillin and 10’000 µg/ml streptomycin (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... human HDL (Millipore), human LDLs (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... human LDLs (Millipore) or an in vitro reconstituted NS1-HDL mix were analyzed by size exclusion chromatography on a Superdex 200 10/300 column (GE healthcare) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human hemoglobin (Sigma) was dissolved in PBS to 10 mg/mL or 1 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Human DPP4 (Sigma) was used as a control in PBS at 50 ng/μL (0.585 μM) ...
-
bioRxiv - Cell Biology 2020Quote: Caco-2 (human epithelial colorectal adenocarcinoma cell line) cells were purchased from ATCC and cultured in DMEM high glucose media (Sigma). The cells were trypsinized using 0.25% trypsin-EDTA and resuspended in the fresh media ...
-
bioRxiv - Immunology 2021Quote: ... the following components were added: 2 mM L-Glutamine (Fisher), 10% heat-inactivated (56°C, 60 min) human AB serum (Sigma), 12.5 mM HEPES (Fisher) ...
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1,500 mg/L sodium bicarbonate (ATCC) supplemented with 2 ng/ml recombinant human Granulocyte-Macrophage Colony-Stimulating Factor (Sigma-Aldrich) and 10 % fetal bovine serum ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... All single-cell samples were distributed at 0.5×106 cells/mL for live staining with monoclonal mouse anti-human FOLR1 IgG1 (LS Bio) in DPBS with 2% v/v FBS (Sigma). Secondary staining for target was performed using QIFIKIT® (BIOCYTEX ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite cultures were maintained in a sus-pension of human erythrocytes at 2% hematocrit in complete media (RPMI-1640, Millipore-Sigma, supplemented with 27mM sodium biocarbonate ...