Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC infected with VE-cadWT-RFP or VE-cadDEE-RFP adenovirus were treated for 2 hours with 1μM Cytochalasin D (Sigma #C8273) immediately after wounding ...
-
bioRxiv - Cell Biology 2019Quote: ... Bcl2/Adenovirus E1B 19 kDa and protein-interacting protein 3-like (BNIP3L/NIX) from Sigma-Aldrich (St. Louis, MO, USA), perilipin (PLIN ...
-
bioRxiv - Plant Biology 2023Quote: ... goat α-luciferase (Sigma Aldrich, St ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was determined from 10 μL of plasma by High Performance Liquid Chromatography (HPLC) on a HPLC SUPELCOSIL™ LC-18 column (5 μm particle size; Sigma-Aldrich) with UV detection at 254 nm (Jasco ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting fragments were subsequently cloned into p3xFLAG-CMV-14 (Sigma) or pGEX-6P-1 (GE Healthcare ...
-
bioRxiv - Genomics 2019Quote: ... cymostatin and phosphatase inhibitors (type I and type II, Sigma-Aldrich). Lysates were centrifuged at 20K × g for 15 minutes at 4°C and clear extract was collected and stored at −80°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... RD cells were transduced with shRNA control lentivirus particles or shMCU lentivirus particles with polybrene (8μg/ml) (Sigma-Aldrich Inc.). Transduced cells were selected with 1μg/ml puromycin (Sigma-Aldrich Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: Stable RNAi-mediated knockdown of TRMT2A was achieved by infection of HEK293T cells with commercially available Lentiviral particles (MISSION® shRNA Lentviral Transduction Particles NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin ...
-
bioRxiv - Cancer Biology 2021Quote: ... or scrambled negative control lentiviral particles (SMARTvector Non-targeting hCMV-TurboGFP Control Particles, Dharmacon, #S-005000-01) and polybrene transfection reagent (Millipore). The packaged viral vectors encode green fluorescent protein (GFP ...
-
bioRxiv - Biophysics 2023Quote: ... and compared the number of fluorescent particles in the sample containing proteoliposomes with the number of particles (micelles) after adding 2% octyl glucoside (Sigma) and 3% deoxy big CHAP (Anatrace ...
-
bioRxiv - Neuroscience 2023Quote: ... minced using sterile razor blades and digested in a 5 mL tube containing 3-5 mL of the digestion mix at 37 °C for 90 minutes: Collagenase type V (Sigma-Aldrich C9263; 5 mg/mL) and Dispase II (Gibco 17105041 ...
-
bioRxiv - Developmental Biology 2020Quote: ... cerevisiae particles stained using calcofluor staining solution (Sigma).
-
bioRxiv - Bioengineering 2021Quote: ... with metallic silver particles (Sigma-Aldrich, MO, USA) and loaded the mixture into a syringe that was calibrated to hold 10 μL of Injectrode material ...
-
bioRxiv - Physiology 2023Quote: ... shRNA lentiviral transduction particles were purchased from Millipore-Sigma to deliver and stably express shRNAs in MEFs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples having a volume of 10 µL were removed at various time points and quenched with 5 µL of 3x loading buffer (5% Ficoll-type 400, 25% glycerol, 1.5X TBE, 20 mM EDTA, 0.5% SDS, 0.1% NP40 (Sigma 74385) and 160x excess of capture oligo ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5 D RGs were freshly dissected and treated with 125 U/ml type XI collagenase (Sigma-Aldrich) dissolved in DMEM (Hyclone ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-coated with collagen type I rat tail (1:10 diluted in sterile water, Sigma, #9007-34-5), and the day after ...
-
bioRxiv - Cancer Biology 2024Quote: ... β-estradiol was removed at day 5 from Type 2 medium and DMSO (Sigma, #D2650; final concentration = 0.1%) or 4-hydroxytamoxifen (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... The OD of the resuspended particles was measured and the particles were transferred to a 14kDa MWCO dialysis tube (Sigma D0405) secured with clips ...
-
bioRxiv - Cell Biology 2022Quote: ... Washed SP3 beads (Sera-Mag (TM) Magnetic Carboxylate Modified Particles (Hydrophobic, GE44152105050250), Sera-Mag(TM) Magnetic Carboxylate Modified Particles (Hydrophilic, GE24152105050250) from Sigma Aldrich) were mixed equally ...
-
bioRxiv - Cell Biology 2023Quote: ... Washed SP3 beads (SP3 beads (Sera-Mag(TM) Magnetic Carboxylate Modified Particles (Hydrophobic, GE44152105050250), Sera-Mag(TM) Magnetic Carboxylate Modified Particles (Hydrophilic, GE24152105050250) from Sigma Aldrich) were mixed equally ...
-
bioRxiv - Developmental Biology 2021Quote: ... type VI (Sigma R6625), 1% SDS ...
-
bioRxiv - Microbiology 2022Quote: Type IX trypsin (Sigma) for 30 min at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... collagenase type IV (Sigma) and DNAse I (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Type V neuraminidase (Sigma) was added to a final concentration of 1 U/mL and incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Type III (Sigma-Aldrich), 5 U/mL rabbit muscle L-lactic dehydrogenase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Type XI (Sigma-Aldrich), 500 µM phosphoenolpyruvate and 50 µM NADH ...
-
bioRxiv - Cell Biology 2022Quote: ... a custom pLKO.1-puro-CMV- TurboGFP was purchased from Sigma-Aldrich, expressing a shRNA previously shown as efficiently targeting the CDS of PFN1 (5’- CCGGCGGTGGTTTGATCAACAAGAACTCGAGTTCTTGTTGATCAAACCACCGTTTTT-3’)79 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... transfection with the pLKO.1-Neo-CMV-tGFP vector (Sigma-Aldrich, USA) was used to label cells with GFP.
-
bioRxiv - Plant Biology 2019Quote: ... Supernatants (300 µl) were collected and added with 5 µl β-glucuronidase (Sigma, type HP-2S, 9.8 units/ml). Reaction on/off was carried out as previously described ...
-
bioRxiv - Cell Biology 2022Quote: ... to perfuse the infrarenal aortic segment for 5 min with sterile isotonic saline (NaCl2, 0.9 %) containing type I porcine pancreatic elastase (2.5 U/mL, Sigma-Aldrich) at 120 mmHg ...
-
bioRxiv - Cell Biology 2023Quote: ... and the liver was first perfused with 1x PBS (containing 0.5 mM EDTA) for 5 minutes and then perfused with digestion buffer containing collagenase type IV (Sigma) and DNase I for 7-10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... and incubated for 1 hr with 5 mg/mL collagenase type I (Sigma, cat#C0130-500MG, St Louis, MO) diluted in HBSS supplemented with 0.1 ug/mL TLCK trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: 0.025 mg/ml of luciferase (Sigma) was unfolded in unfolding buffer (8 M guanidine hydrochloride ...
-
bioRxiv - Cell Biology 2019Quote: ... Luciferase (Sigma-Aldrich, #L0159, 1:200); Collagen I (Cedarlane Labs ...
-
bioRxiv - Biophysics 2021Quote: ... Particles are coated non-specifically by streptavidin (Sigma-Aldrich) by incubation overnight in a 0.01 g/ml streptavidin / phosphate buffered saline solution ...
-
bioRxiv - Bioengineering 2021Quote: ... titanium particles (2.5wt%, 21-nm nominal diameter, Sigma Aldrich) were added to the base PDMS ...
-
bioRxiv - Cell Biology 2021Quote: ... Concentrated lentiviral particles were supplemented with polybrene (SIGMA; H9268) and incubated with W4 cells at 80% confluency ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral particles were then purified over iodixanol (Sigma-Aldrich) step gradients and concentrated using Amicon filters (EMD) ...
-
bioRxiv - Biophysics 2019Quote: ... coli 70S Ribosome particles were purchased from Sigma-Aldrich, Trastuzimab and IgG1-RGY samples were provided by the team of Janine Schuurman at Genmab (Utrecht ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 μL of magnetic streptavidin particles (Sigma-Aldrich 11641778001) were first washed twice with PBS and spun down at 1500 xG and added to the solution ...
-
bioRxiv - Cell Biology 2021Quote: ... were infected with customized AmotL2 shRNA Lentiviral particles (Sigma) or scrambled shRNA control virus in complete endothelial cell medium with 5 μg/mL polybrene (Vector Builder) ...
-
bioRxiv - Cell Biology 2020Quote: BBS10 shRNA lentivirus particles were purchased from Sigma (St.Louis). The sequences of the two shRNAs selected were ...
-
bioRxiv - Cancer Biology 2022Quote: ... Titrated viral particles and polybrene (8 µg/ml, Sigma) were applied to the culture (2 × 105 cells/well in 6-well plates ...
-
bioRxiv - Bioengineering 2023Quote: ... and hydroxyapatite (HA; 2.5 μm2 particle sizes50; Sigma-Aldrich) were incorporated into biomaterials by melt-blending at 190 ºC for 3 mins in a DSM 15 cc mini-extruder (DSM Xplore) ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral particles infected A549 cells with polybrene (Sigma, USA) at a final concentration of 8ug/ml ...
-
bioRxiv - Cell Biology 2023Quote: Mission TM lentiviral transduction particles were purchased from Sigma. The pLKO puro lentiviral vector expressed a short hairpin RNA (shRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... Murine skin fibroblasts were prepared by collagenase (Type II and Type IV, Sigma) digestion of abdominal skins dissected from a female BiP-FLAG-Heterozygous (Het ...
-
bioRxiv - Cell Biology 2019Quote: ... Firefly Luciferase siRNA was used as a negative control (MISSION® esiRNA Firefly Luciferase, EHUFLUC, Sigma Aldrich).