Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for 8 Chloro 2 3 4 5 tetrahydropyrido 3 2 f 1 4 oxazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed three times in PBS and mounted in 70% glycerol with with 5 μgml-1 concentration of 4-6-diamidino-2-phenylindole (DAPI, Sigma) and cells were mounted on cover slips ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Biophysics 2020Quote: 2% Pluronic F-127 (Sigma, P2443) in 5 mM Tris pH 8 ...
-
bioRxiv - Biophysics 2019Quote: ... and f/2 nutrient solution (Sigma) in 500 ml quantities excluding the sodium-glycerophosephate to reduce any precipitation in the medium ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% Pluronic® F-68 (Sigma) treated elastomeric barriers (Polydimethylsiloxane (PDMS ...
-
bioRxiv - Biophysics 2024Quote: ... which was prepared with 20 mM HEPES-buffer (2-(4-(2-Hydroxyethyl)-1- piperazinyl)-ethansulfonsäure) (Sigma-Aldrich, ≥99.5 %, H3375) as calcium chloride is not soluble in DPBS-buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EDTA with freshly added 1 mM DTT), then concentrated to 500 μl using Amicon Ultra-4 (4 mL, 3 kDa cut-off) (Millipore, Darmstadt, Germany, UFC800324) and loaded onto a Superdex75 10/300 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were seeded into 6-well plates to reach 50-60% confluency on the day of infection and were transduced 2-3 consecutive days with the viral supernatant in the presence of 8 μg/mL polybrene (Sigma). The viral supernatant was replaced with fresh culture medium ...
-
bioRxiv - Immunology 2020Quote: ... 8-20 weeks after reconstitution chimeric mice were injected intraperitoneally for 3 d with 2 mg/day of tamoxifen (Sigma) re-suspended at 20 mg/ml in corn oil (Sigma ...
-
bioRxiv - Systems Biology 2024Quote: ... 2M thiourea, 100mM Tris-HCl, pH 8, 150mM NaCl, 1mM EDTA, phosphatase inhibitor cocktail 2 and 3, 10mM NaF; Sigma), reduced with 10mM DTT (dithiothreitol ...
-
bioRxiv - Bioengineering 2019Quote: ... 8 mM MgCl2 (7786-30-3, Sigma), and 10 mM dithiothreitol (20-265 ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 mM 8-bromoadenosine 3□,5□-cyclic monophosphate (Sigma-Aldrich, Saint Louis, MO, USA), 1 μM medroxyprogesterone acetate (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 100 nM 8- Bromoadensoine 3’,5’-cyclic monophosphate sodium salt (Sigma, Cat#B7880) was added ...
-
bioRxiv - Bioengineering 2019Quote: 1 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-NaOH buffer pH 7 (Sigma-Aldrich)
-
bioRxiv - Cell Biology 2019Quote: ... Some PAs were treated with XE991 (3·10-8-3·10-6, Sigma) before the stimulation with 5-HT and then the relaxation induced by SNP was tested.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Systems Biology 2022Quote: ... Cultures were treated with the indicated amount of 1-(1,1-dimethylethyl)-3-(1-naphthalenyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (1-NM-PP1; Millipore Sigma), taken from a 10,000x stock in DMSO ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...
-
bioRxiv - Biophysics 2019Quote: ... The eluate was incubated for 3 h at 4°C with 5 mL of FLAG M2 Agarose beads (Sigma), collected in a glass column ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell disruption was carried out by vortexing (3 cycles, 5 min each) at 4°C using 0.2 ml of glass beads (425-600 μm; Sigma). For the Rpb3 immunopurification ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were lysed in 3 ml BugBuster HT (Millipore, #70922-4) for 30 min at room temperature on a rotator ...
-
bioRxiv - Microbiology 2019Quote: ... the DMEM containing 3% FBS and 4% sodium carboxymethyl cellulose (CMC) (Sigma) were added to the cells and cultured for 5 days ...
-
bioRxiv - Pathology 2021Quote: ... N″-triacetylchitotrioside [4-MU-β-(GlucNAc)3] (Sigma, St. Louis, MO, USA) as the substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Cyc (D-4-amino-3-isoxazolidone, 20 μg/μl; Sigma-Aldrich), AP5 (2-amino-5-phosphonopentanoate ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Biophysics 2024Quote: ... O2 scavenger system (7.1 mM PCA (3, 4-Dihydroxybenzoic acid, 37580, Sigma) with 29 nM PCD (Protocatechuate 3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... After 4 days, cells were switched to DMEM/F-12, HEPES (31330038, Thermofischer Scientific) with 2% Horse serum (H1270, Sigma-Aldrich). Before staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Cancer Biology 2022Quote: ... asynchronously growing subconfluent cells were labeled with 30 μM thymidine analogue 5-chloro-2’-deoxyuridine (CIdU) (#C6891, Sigma-Aldrich) for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 um silicon dioxide beads (66373-5ML-F, Sigma) or 3 um red-fluorescent silica beads (40-00-303 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were washed 2× in PBS and then counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; 1:10 000; Sigma) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted in 1% normal donkey serum in PBS with 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were then incubated overnight at 4°C with PBS-T containing 2% NGS and antisera against Olig-2 (1:500,Millipore) A2B5 (which stains for OPCs ...
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... in PBS for 2 h at room temperature and counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Sigma-Aldrich) to identify cell nuclei.
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Microbiology 2023Quote: ... Washed beads were adjusted to pH 7.5 with 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and bound proteins were reduced using 5 mM dithiothreitol (Sigma-Aldrich) at 37°C for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore Sigma #P5726 and #P0044). Cells were scraped ...