Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 7H 9 6 Methenofuro 2 3 f oxacycloundecin 2 7 3H dione 3a 4 5 9 10 12a hexahydro 11 methyl 3 methylene 3aR 9S 11E 12aS 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... α-[amino-[(4-aminophenyl)thio]methylene]-2-(trifluoromethyl)-benzene-acetonitrile (SL327; Sigma-Aldrich) was dissolved in 5% DMSO ...
-
bioRxiv - Neuroscience 2019Quote: ... BW723C86 (α-methyl-5-(2-thienylmethoxy)-1H-Indole-3-ethanamine monohydrochloride) and a primary antibody raised against β-actin were purchased from Sigma (USA). Other primary antibodies ...
-
bioRxiv - Genomics 2022Quote: The stable cell lines constantly expressing the minigenes were subjected to four time points (0, 3, 6, and 9 h) of post actinomycin D treatment (final concentration of 1 μg/mL; Sigma, no. A9415) treatment in three biological replicates ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Microbiology 2020Quote: Pseudomonas aeruginosa PQS (2-nonyl-3-hydroxy-4-Quinolone, Sigma, Israel) was dissolved in DMSO to 10 mM concentration ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Biochemistry 2019Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3% 2-Hydroxyethyl Agarose (Sigma) was prepared and stored in a water bath at 45 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... 3% 2-mercaptoethanol (Sigma Aldrich), and 0.25 mg/ml Proteinase K (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 and 3 (Sigma-Aldrich). The homogenate was sheared through a 26-gauge needle and sonicated three times for 20-second bursts ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were incubated with 10μM 1,2-dioleoyl-sn-glycero-3-phospho-L-serine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (18:1 NBD-PS) (1:300, Sigma-Aldrich) for 15 minutes at 25°C ...
-
bioRxiv - Immunology 2019Quote: ... 3-Methyl-Adenine (3MA) (Sigma, #M9281), Paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: ... and 10 mg/mL DAPI (4’,6-diamidino-2-phenylindole; Sigma) were added with secondary antibodies at 1:100 and 1:10,000 dilutions ...
-
bioRxiv - Biochemistry 2020Quote: ... ampholyte high resolution pH 7–9 were purchased from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2-methyl-2-propanethiol (Sigma 109207), 0.01% acetophenone (Sigma W200910) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% 2- methyl-2-thiazoline (Sigma M83406), 1% citronellol (Sigma W230915) ...
-
bioRxiv - Cell Biology 2022Quote: ... Media was changed every 2-3 days for new media: DMEM/F-12 (Sigma-Aldrich) + 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Immunology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, 28718-90-3, St Louis, MO, USA). The results were recorded using Zeiss LSM780 confocal system (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: ... The animals received unilateral injections totalling 3×2 μg of 6-OHDA (Sigma Chemical CO ...
-
bioRxiv - Biophysics 2022Quote: ... a 16 mM Direct red 81 (CAS Nr 2610-11-9, Sigma Aldrich) or Amaranth dye solution (CAS Nr 915-67-3 ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-amino-3-phosphonopropionic acid (AP-3, Sigma-Aldrich A4910), ATP (Sigma-Aldrich A2383) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... N’-methylene bisacrylamide (2% wt/vol, Sigma-Aldrich) were mixed with distilled water to obtain gels of 10 kPa stiffness (Tse and Engler ...
-
bioRxiv - Immunology 2019Quote: C57BL/6 mice (female, 9-10 weeks old) were nebulised with LPS (3 mg per group of 8 mice) (Pseudomonas aeruginosa, Sigma-Aldrich) and immediately injected intraperitoneally (i.p. ...
-
bioRxiv - Immunology 2023Quote: ... 9 and rh10) and divided into 3 pools (15-mers overlapping by 10 aa, Sigma-Aldrich, United States or Mimotopes, Australia). A negative control consisted of unstimulated cells (medium only) ...
-
bioRxiv - Zoology 2020Quote: ... 3-methyl-but-2-enyl acetate and (2E)-hex-2-enyl acetate were confirmed with analytical standards from Sigma-Aldrich (St. Louis, MO). For the analysis of CHCs ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... and the AMPA receptor inhibitor 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, 10 µM, Sigma Aldrich, St Louis, MO, USA). This solution was applied to the autaptic culture neurons for 2 min ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... 9 and 10 hrs post infection) 2 ml culture was filtered through a 0.45 µm filter (Millex, SLHV033RS, Millipore) and the filtrate was kept at 4°C until analysis (for a maximum of 2 weeks) ...
-
bioRxiv - Cell Biology 2023Quote: ... and CellEvent™ Caspase-3/7 green ReadyProbes™ Reagent (2 drops/ml, Sigma, R37111) for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: A solution of methimazole (1-methyl-3H-imidazole-2-thione) (CAS 60-56-0; MW: 114,17; Sigma-Aldrich) was used to induce hypothyroidism ...
-
bioRxiv - Cancer Biology 2021Quote: ... The matrix solution consisted of 10 mg/ml 9-aminoacridine hydrochloride monohydrate (9-AA) (Sigma-Aldrich, Germany) in water/methanol 30:70 (v/v) ...
-
bioRxiv - Neuroscience 2020Quote: 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) was obtained from Sigma-Aldrich (Cat No. C127). Tetrodotoxin (TTX ...
-
bioRxiv - Neuroscience 2021Quote: ... MK-801 and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) all purchased from Sigma-Aldrich, also with AR-C155858 and (S)-3,5-Dihydroxyphenylglycine hydrate (DHPG ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 µM 9-cis-Retinoic Acid (Sigma-Aldrich) and/or 5 nM human β-NGF (Peprotech) ...
-
bioRxiv - Immunology 2024Quote: ... containing X-tremeGene-9 (Sigma Aldrich; 10 µL) according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... (phenylmethylsulfonyl fluoride, PMSF 1mM; 1-chloro-3-tosylamido-4-phenyl-2-butanone, TPCK, 10 μg/ml; aprotinin, 10 μg/ml Sigma) incubated for 30min on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...