Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 7 Chloro 3 methyl 3H 1 2 3 triazolo 4 5 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma). Particulate was removed by centrifugation of lysates at 21,000 g for 15 minutes at 4°C and filtration through 0.45 µm syringe filters ...
-
bioRxiv - Neuroscience 2019Quote: ... with Actinomycin D (3 µM, Sigma-Aldrich, MO, USA). 1 mm thick coronal slices (between Bregma –1.22 mm and −2.46 mm ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (BC-1, BCBL-1) or 20% (BC-2, BC-3, BC-5, BJAB) Serum Plus-II (Sigma-Aldrich, catalog number 14009C ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading/transmigrating cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... recombinase expression was induced with 3-methyl-benzoate (Sigma: T36609; M-Toluic Acid 99% purity) at final concentration of 1 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... D-(–)-2-Amino-5-phosphonopentanoic Acid (D-APV, Sigma-Aldrich) 80 µM ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.15 M 2-amino-2-methyl-1-propanol (AMP) (A65182, Sigma-Aldrich) in UPW ...
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Neuroscience 2024Quote: ... 7-aminoactinomycin D (7-AAD, Sigma-Aldrich) was added to stain dead cells ...
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... and 2-[2-(3-chlorophenyl)hydrazinylidene]-propanedinitrile (CCCP) (Sigma), were used at final concentrations of 0.5 μM ...
-
bioRxiv - Biochemistry 2022Quote: ... 2-[2-(3-chlorophenyl)hydrazinylyidene]propanedinitrile (CCCP) (Sigma-Aldrich), rhodamine 123 ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...
-
bioRxiv - Microbiology 2022Quote: ... and 2-Heptyl-3-hydroxy-4(1H)-quinolone (pqs, Sigma-Aldrich CAS# 108985-27-9) alone and in combination ...
-
bioRxiv - Biophysics 2023Quote: Thoraces from 2–3-day-old adult Drosophila were dissected in 4% paraformaldehyde (PF, Sigma))) ...
-
bioRxiv - Cancer Biology 2021Quote: Cell viability was determined using the 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium assay (MTT assay, Cat. No. M5655, Sigma-Aldrich, St. Louis, MO). Cells were plated in 96-well plates ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 998.9µM 1-methoxy-5-methylphenazinium methyl sulfate (M8640, Sigma-Aldrich), 1.5mM nitroblue tetrazolium (#484235 ...
-
bioRxiv - Plant Biology 2023Quote: D-NMG base: N-Methyl-D-glucamine (Sigma-Aldrich, cat # 66930)
-
bioRxiv - Biochemistry 2020Quote: ... The protein was then labeled with the MDCC (7-Diethylamino-3-[N-(2-maleimidoethyl) carbamoyl]coumarin) from Sigma-Aldrich. Unreacted MDCC was removed by ion exchange using a Bio-Rex70 column ...
-
bioRxiv - Immunology 2022Quote: ... To asses mitochondrial fuel usage OCR was measured subsequent to the addition of the following drugs in different combinations as indicated: 3 μM bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES) (SML0601, Sigma), 2 μM UK-5099 (PZ0160 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated for 2 hours with 3 µg/ml 5-bromo-2’-deoxyurine (Sigma-Aldrich, B5002). Cells were then detached using trypsin/EDTA (GIBCO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Sigma Aldrich #39391), and 3NPH solutions were mixed ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2023Quote: The mice received three injections every 2 h (200 ul/injection, intraperitoneally in alternative sites of the body) of 5-Chloro-2’-deoxy-Uridine (CldU, Sigma reference C6891 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% methyl cellulose (Sigma-Aldrich), 1% pen/strep antibiotics and 1% NEAA ...
-
bioRxiv - Biophysics 2022Quote: ... We dissolve 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methyl-morpholinium chloride (DMTMM) powder (Sigma Aldrich) in HEPES buffer (pH 7.18 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... polyps were incubated in 25 M 5-methoxy-2-methyl-indole (Sigma M15451) at 68°F for an hour (Fuchs et ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Biochemistry 2019Quote: ... 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranosyl 5’-monophosphate (ZMP; Sigma Aldrich, St. Louis, MO) at a stock concentration of 50 mM in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-3 mL mineral oil (M8410, Sigma) was used to fully overlay the droplets to prevent the evaporation.