Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of 6-OHDA in 0.01% ascorbate (Sigma–Aldrich) into the median forebrain bundle (MFB ...
-
bioRxiv - Neuroscience 2023Quote: ... 2,2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS, Sigma-Aldrich) substrate was added to each well ...
-
bioRxiv - Plant Biology 2020Quote: ... and anti-α-tubulin antibodies (clone B-5-1-2, Sigma-Aldrich) at 1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... at 1:1000 dilution and monoclonal antibody B-5-1-2 (Sigma) at 1:1000 dilution to detect α-tubulin as loading control.
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Biochemistry 2021Quote: ... α-TUBULIN (ms, clone B-5- 1-2, Sigma T9026, 1:5000), rabbit IgG (gt ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Tubulin (T5168, Clone B-5-1-2) was from Sigma Aldrich.
-
bioRxiv - Biochemistry 2021Quote: A monoclonal anti-α-tubulin (SIGMA, T5168, Clone B-5-1-2) was used in western blots as a loading control ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...
-
bioRxiv - Immunology 2022Quote: ... or α-Tubulin (clone B-5-1-2, Sigma-Aldrich, Cat#T5168). Primary antibodies were revealed with IRDye® 680 Goat anti-Mouse IgG or IRDye® 800CW Goat anti-Rabbit IgG (LI-COR ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Immunology 2022Quote: ... 5% b-ME) supplemented with protease and phosphatase inhibitors (Roche/Sigma-Aldrich). A Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and anti-α-tubulin B-5-1-2 monoclonal primary (T5168, Sigma), followed by goat-anti mouse IRDye 680 goat anti-mouse IgG secondary antibodies (926-68070 ...
-
bioRxiv - Molecular Biology 2023Quote: ... B cells were stimulated with 5 μg/ml LPS (Sigma, L7770-1MG), 10 ng/ml mouse recombinant IL-4 (Peprotech ...
-
bioRxiv - Immunology 2021Quote: ... Optical density following development with 3-amino-9-ethylcarbazole (AEC) substrate (Sigma Aldrich, Saint Louis, MO, USA) was used to calculate the 50% micro neutralization titer (50% MN ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fixed embryos were washed with 3%HCl/70%EtOH solution for 3 times and stained in 1% Victoria blue B (Sigma) dissolved in 3%HCl/70%EtOH overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with DPBS five times for 3 min each, and stained with 4’, 6-diamidino-2-phenylindole (DAPI, 1 μg/mL in PBS) (Sigma, San Francisco, CA, USA) in the dark at room temperature for 8 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... MOLM-13 and MV-4-11 cell lines were cultured using RPMI-1640 medium (Sigma-Aldrich, U.S.) supplemented with 2mM GlutaMAX (Thermofisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... see Figure S1A and 22) added to the cells with 400 µg/ml of poloxamer-407 (Sigma, 9003-11-6) and incubated in a 37°C CO2 incubator for another 24 hours (Figure 1A) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 mM citric acid (pH 6.0) (Sigma Aldrich, 77-92-9), 0.1% Tween20 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... or goat-anti-MMP-9 (Matrix metallopeptidase 9, Sigma-Aldrich M9570). Both antibodies were diluted in the blocking solution with 0.2% Triton X-100 (1:1000 and 1:500 for anti-NeuN and anti-MMP-9 ...
-
bioRxiv - Genomics 2019Quote: ... About 5×10^5 to 5×10^6 cells were crosslinked with final 1% formaldehyde (Sigma, F8775-500ML) for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Cancer Biology 2020Quote: ... using a 20 min linear gradient from 5% B to 35% B (A: 20 mM ammonium formate (cat No. 70221, Sigma, USA) in water ...
-
bioRxiv - Microbiology 2021Quote: ... the protein was eluted with 6 ml buffer B containing 15 mM d-desthiobiotin (Sigma Aldrich). Purification of GyrA-N-Strep and GyrB-C-Strep were conducted in the same way using an adjusted buffer Bgyr for cell disruption and purification (buffer Bgyr ...
-
bioRxiv - Neuroscience 2024Quote: ... gently dounce-homogenized (KIMBLE Dounce tissue grinder, Sigma D8938, 6 strokes with A and B pestle), and incubated for 5 minutes in a total of 4 ml EZ buffer.
-
bioRxiv - Microbiology 2019Quote: ... and 4 mg polymyxin B (EMD Millipore Corp., USA, cat. no. 5291-500MG) in a mixture of 1 ml of Mueller-Hinton broth (BD Diagnostics Systems ...
-
bioRxiv - Microbiology 2021Quote: ... Dilutions were plated on 1/4-diluted King’s B+++ Agar plates (Sigma-Aldrich) supplemented with 13 mg/L chloramphenicol ...
-
bioRxiv - Bioengineering 2022Quote: ... lungs were rinsed with antibiotics/antimycotics (10% P/S, 4% amphotericin-B [Sigma] ...
-
bioRxiv - Bioengineering 2021Quote: methoxy-(polyethylene glycol)-N-hydroxysuccinimid (Molecular Weight (MW): 2000 Da) was purchased from Sigma-Aldrich. 30 pl of 100 mM methoxy-PEG2000-NHS in dry DMSO were added to 100 μl mEGFP::HCF (10 μM ...
-
bioRxiv - Microbiology 2021Quote: ... N-methyl-trimethyl-silyl-trifluoroacetamide (MSTFA) and methoxyamine pyridine hydrochloride were of chromatographic grade and purchased from Sigma–Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 15μM DIG-11-dUTP (Digoxigenin-11-dUTP, alkali-labile, Sigma, Cat# 1157315291) in a 1X DNA polymerase reaction buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... tritici IPO323 at 9 DPI were incubated in 5 M sorbitol (Sigma-Aldrich, UK, Cat#S1876) for one hour prior to mounting (in the same solution ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...