Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 6 fluoronaphthalene 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 1% non-essential amino acids and 15□μM HEPES (Sigma). All cells were cultured at 37°C supplied with 5% CO2 and 95% humidity ...
-
bioRxiv - Cell Biology 2023Quote: ... washed with 1 ml of 20 % trichloroacetic acid (Sigma-Aldrich) and snap-frozen on dry ice ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1ml L−1 non-essential amino acids (M7145, Sigma Aldrich), hydrocortisone ...
-
bioRxiv - Genomics 2023Quote: ... 1 mol/l of Ethylenediaminetetraacetic Acid Disodium (EDTA, Sigma #ED2SS). Thirty µl of superparamagnetic microbeads conjugated to a CD56 primary antibody (Miltenyi #130-050-401 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% MEM Non-essential Amino Acid Solution (100X) (Sigma-Aldrich), and 1% Antibiotic-Antimycotic-stabilized suspension (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 1% MEM non essential amino acids (Sigma, M7145), 1% Glutamax (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... and 1% (v/v) non-essential amino acids (Sigma-Aldrich), and maintained at 37°C in 5% CO2.
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Bioengineering 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Sigma-Aldrich, USA), sodium hydroxide (Sinopharm Chemical Reagent Co. ...
-
bioRxiv - Biophysics 2024Quote: ... and 2:1 protocatechuic acid/protocatechuate-3,4-dioxygenase (Millipore Sigma).
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was stopped with 1% acetic acid (Sigma-Aldrich), and the peptide mixtures were desalted on C-18 reverse phase material (ZipTip μ-C18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... free fatty acids (myristoleic acid, Sigma-Aldrich, M3525; palmitoleic acid, Sigma-Aldrich, P9417; oleic acid, Sigma-Aldrich, O1008), squalene (Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... 10-200 mg tissue was digested in 1 ml 3 N hydrochloric acid (Fisher)/10% trichloroacetic acid (Millipore Sigma) at 65 °C for two days ...
-
bioRxiv - Microbiology 2021Quote: ... 6-BAP (6-Benzylaminopurine, Sigma-Aldrich) was dissolved in 10mM NaOH and added to PDA media of full ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-hydroxydopamine (6-OHDA; Sigma-Aldrich) was dissolved freshly into sterile 0.9% NaCl and 0.2% ascorbic acid immediately prior to administration to minimize oxidation ...
-
bioRxiv - Molecular Biology 2021Quote: ... free fatty acids (myristoleic acid, Sigma-Aldrich, M3525 ...
-
bioRxiv - Biochemistry 2021Quote: Tannic acid and gallic acid (Sigma Aldrich) were dissolved in 150 μM of a combination of citric acid (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... diluted at 1:500 and acetylated-tubulin antibody (Sigma-Aldrich, 6-11B-1) at 1:500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Sigma, cat. T6793), 1:50 mouse anti-Synapsin (clone 3C11 ...
-
bioRxiv - Genetics 2022Quote: ... and mouse anti-acetylated tubulin (1:5000, Sigma-Aldrich, clone 6-11B-1). Slides were washed three times in PBS and subsequently incubated for 1 h at room temperature in blocking buffer containing the secondary antibodies conjugated to Ig-Alexa Fluor 568 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-acetylated tubulin clone 6-11B-1 (1:500, Sigma-Aldrich, T6793), mouse anti-gamma tubulin GTU-88 (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-acetylated tubulin at 1:1000 (6-11B-1, Sigma-Aldrich). Fluorescent secondary antibodies conjugated to AlexaFluor488 and AlexaFluor564 were used at 1:500 (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-acetylated tubulin (Sigma-Aldrich, clone 6-11B-1, 1:1000) rabbit polyclonal anti-POC5 (A303-341A-T ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse anti-acetylated α-tubulin (1:2,000; 6–11B-1; Sigma-Aldrich T6793), rat anti–E-cadherin (1:1,000 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The plates were incubated for two hours at RT and 2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) substrate solution (Sigma-Aldrich, USA) was added for colour development ...
-
bioRxiv - Bioengineering 2020Quote: ... nalidixic acid (NA; N8878, BCBW6556), and 4′,6-diamidino-2-phenylindole (DAPI; D9542, 28718-90-3) were purchased from Sigma Aldrich, USA ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 × 107 PFU per ml of MNV-1.CW3 were incubated at temperatures ranging between 0 and 56°C for 2 or 6 h in the presence or absence of 500 μM bile acid (sodium glycochenodeoxycholate GCDCA, Sigma Aldrich) by enumeration by plaque assay.
-
bioRxiv - Microbiology 2020Quote: ... which was added to the growth media from an Fe(III)-citrate solution prepared by mixing Fe(III)Cl3 (6 mM) and citric acid (12 mM) powders (Sigma-Aldrich) in Milli-Q water ...
-
Development of follicular dendritic cells in lymph nodes depends on retinoic acid mediated signalingbioRxiv - Immunology 2020Quote: ... cells were cultured for 6 hrs either in medium alone or in the presence of retinoic acid (100 nM, Fluka, Sigma-Aldrich, Zwijndrecht ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: To establish folic acid (FA)-induced nephropathy, mice (25-30g, n= 6-10 mice per group) were injected intraperitoneally with FA (F7876, Sigma-Aldrich, dissolved in 0.3M sodium bicarbonate at a dose of 250 mg/kg) ...
-
bioRxiv - Plant Biology 2023Quote: ... and supernatant was mixed with 6 μL loading buffer (750 mM ε-aminocaproic acid and 5% (w/v) pure Coomassie Brilliant Blue G (B0770, Sigma)) and loaded onto a 6-12% gradient polyacrylamide gel ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-well plates in maintenance media (base culture media further supplemented with 150 µM ascorbic acid (AA, Sigma, cat. no A4544), 3 µM CHIR-99021 (Axon Medchem ...
-
bioRxiv - Molecular Biology 2024Quote: ... for differentiation induction 100.000 cells were plated in a 6-well plate and maintained in complete media supplemented with 20μM retinoic acid (Sigma-Aldrich, R2625) in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...