Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 6 Phenylamino 2 3 dihydro 1H indolizin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, #MBD0015) and TRITC-conjugated Phalloidin (Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL of 2-mercaptoethanol (Sigma-Aldrich), and 0.2 g of glass beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma) and/or with SytoxTM Green Nucleic Acid Stain (1:30.000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) and the images were captured under a Leica DMRXA microscope equipped with a Leica DFC310 FX camera (Leica Microsystems).
-
bioRxiv - Cell Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) was done concurrently ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole (Millipore) was used at 1:5,000 dilution.
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma, USA) to confirm representative target location ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 μM 5-Aza-2′-deoxycytidine (5-Aza; Sigma), 250-500 nM CpG-scramble ...
-
bioRxiv - Neuroscience 2021Quote: ... followed one hour later by 3 ng/mL IL1α (Sigma #I3901), 400 ng/mL C1q (MyBioSource #MBS143105) ...
-
bioRxiv - Microbiology 2020Quote: ... blocked for one hour with 3% normal goat serum (Sigma-Aldrich) diluted in PBS-0.1% Tween20 (PBST) ...
-
bioRxiv - Genetics 2022Quote: ... Slides were then rinsed in washing buffer five times for 3 min each and nuclei were stained with 4lr,6-diamidino-2-phenylindole (DAPI, cat # D-1388, Sigma) at a concentration of 1 μg/ml for 10 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were fixed with 3% PFA/PBS and the nuclei stained with 4’,6-diamidine-2’-phenylindole (DAPI, Sigma). An inverted fluorescence microscope (Zeiss ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were also washed for 10 minutes in a solution of 1.25×10−3 mg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Sigma: D9542) in PBS to fluorescently label nuclei within tissue sections.
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Droplets were then demulsified by adding 1H,1H,2H,2H-perfluoro-1-octanol (Sigma Aldrich) dissolved in HFE-7500 (Novec ...
-
Anisotropic Rod-Shaped Particles Influence Injectable Granular Hydrogel Properties and Cell InvasionbioRxiv - Bioengineering 2021Quote: ... The hard master was vapor-coated with Trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Sigma) in vacuum ...
-
bioRxiv - Genomics 2022Quote: ... the collected droplets were broken by 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasma-activated and silanized with vapored trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma-Aldrich) overnight ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by 100 μl of 1H,1H,2H,2H-Perfluoro-1-octanol (PFO; Sigma-Aldrich) were added on top of the remaining top layer ...
-
bioRxiv - Bioengineering 2022Quote: ... molds were treated with vapor deposition of 1H,1H,2H,2H-perfluorooctyl-trichlorosilane (Sigma Aldrich) under vacuum for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... the collected droplets were broken with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich) to collect the capsules ...
-
bioRxiv - Bioengineering 2022Quote: ... PDMS moulds were then functionalised using Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma, 448931). A few drops of silane were placed on a glass petri dish and into a desiccator together with the PDMS moulds ...
-
bioRxiv - Microbiology 2023Quote: ... 5 × 10−5 M 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin ...
-
bioRxiv - Plant Biology 2019Quote: ... Inflorescences of each GUS line were pre-treated with ice cold acetone for 1h at −20°C and washed two times for 5 minutes with 100 mM sodium phosphate buffer followed by one wash with sodium phosphate buffer containing 1 mM K3Fe(CN)6 and 1 mM K4Fe(CN)6 (both Sigma) at room temperature ...
-
bioRxiv - Plant Biology 2021Quote: ... One mL of 2 M TFA stock (Sigma, USA) was added to the methanolic HCl-treated walls and incubated for 1 h at 120°C ...
-
bioRxiv - Neuroscience 2020Quote: ... One intravenous injection of dextran-FITC (Sigma, 2 MD) diluted in 0.9 % saline is provided as the vascular contrast agent for fluorescent imaging.
-
bioRxiv - Neuroscience 2023Quote: ... iii) one bottle of saccharine solution (2%, Sigma Aldrich) and one bottle of nicotine (100 µg/ml free base ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg/mL 4′,6-Diamidin-2-phenylindol (DAPI, Sigma-Aldrich) in 1X PBS was added for 2 min followed by a final washing step ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: HBP inhibition in vivo was achieved by treatment of tumor bearing mice with 3 doses (10 mg/kg) of DON (6-Diazo-5-oxo-L-norleucine, Sigma-Aldrich) every 3 days ...
-
bioRxiv - Biophysics 2021Quote: ... 5(6)-Carboxyfluorescein was purchased from Sigma-Aldrich. Methyl-α-cyclodextrin (MαCD ...
-
bioRxiv - Microbiology 2021Quote: ... 6 mM MnCl2 (Sigma-Aldrich, 7773-01-5), 0.7 mM dNTPs with 10 U SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and 5 U glucose 6-phospahte dehydrogenase (Sigma).
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA (Sigma-Aldrich, 6381-92-6) and protease and phosphatase inhibitors (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...