Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 6 Isopropyl 2 methoxy phenol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... 0.2 ⨯ 10−6/ml l-ascorbic acid-2-phosphate (Sigma-Aldrich), 1% insulin-transferrin-selenous acid (ITS+ Premix ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 Trolox® (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma) and 10 HEPES (250 mOsm ...
-
bioRxiv - Plant Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (cell nuclei staining dye) (Sigma-Aldrich), and images from the root and radical cells were obtained with a fluorescence microscope (Olympus).
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI; Sigma). Anti-rabbit and anti-mouse Alexa Fluor 488-conjugated (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) was purchased from Sigma-Aldrich. For blood recipient analyses ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Conventional confocal imaging was carried out using confocal microscopes LSM780NLO (Zeiss ...
-
bioRxiv - Cell Biology 2022Quote: ... postfixed in 2% OsO4 and 1.5% K4Fe(CN)6 (Sigma-Aldrich) in 0.1 M sodium cacodylate buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma).
-
bioRxiv - Synthetic Biology 2021Quote: ... After staining with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) in PBS for 5 min ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1:1000 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich), for 3h ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were counterstained with 4′6-diamidino-2-phenylindole (DAPI; Sigma). Cells without the addition of primary antibodies served as negative controls ...
-
bioRxiv - Bioengineering 2021Quote: ... Slides mounted with 4’,6-diamidino-2-phenylindole (DAPI, Sigma, D9542) were imaged under the fluorescent microscope (OLYPUS ...
-
bioRxiv - Plant Biology 2019Quote: ... samples were stained with 4’,6-diamidino-2-phenylindole (DAPI; Sigma) at 1 μg mL-1 in PBS buffer for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma-Aldrich) in the dark for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... post-fixed in 2% OsO4 + 1.5% K4Fe(CN)6 (Sigma-Aldrich) in 0.1M sodium cacodylate buffer for 1h ...
-
bioRxiv - Cell Biology 2020Quote: ... For nuclear staining 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) was used ...
-
bioRxiv - Immunology 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St Louis, MO) was used at 200 ng/mL for nuclei staining.
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) containing mounting media (Fluoroshield F6057, Sigma) to visualise nuclear material and were imaged using an Olympus IX-83 fluorescent microscope equipped with an Olympus DP50 camera ...
-
bioRxiv - Cell Biology 2022Quote: ... postfixed in 2% OsO4 and 1.5% K4Fe(CN)6 (Sigma-Aldrich) in 0.1 M sodium cacodylate buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (Sigma) according to May (May ...
-
bioRxiv - Microbiology 2022Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (0.5 μg/ml) (Sigma). Cell images were captured using a Zeiss LSM 900 laser confocal microscope.
-
bioRxiv - Cell Biology 2023Quote: ... and 4',6-Diamidino-2-phenylindole (DAPI, Sigma, D9542, 1:1000). After incubation with secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... 2’,3’,5’-Triacetyl-6-azauridine (azaribine; Sigma-Aldrich, Cat. # T340057), and brequinar sodium salt hydrate (brequinar ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindol (DAPI, Millipore, 1:5000) for 5 min ...
-
bioRxiv - Immunology 2023Quote: ... Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI, Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Glass cover slips were mounted in ImmunoMount (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:1000; Sigma-Aldrich) at room temperature for 2 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (l mg/mL, Sigma Aldrich, Schnelldorf, Germany) for 5 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid; Sigma #238813-1G) was dissolved in 3.2 mL of HPLC grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... SSC (side scatter) and DAPI (4’,6-diamino-2-phenylindole; Sigma). FACS analyses were carried out using BD LSRII flow cytometry (BD Biosciences ...
-
bioRxiv - Developmental Biology 2023Quote: ... DAPI (4”, 6-diamidino-2-phenylindole; Sigma, cat. no. D-9542) was used at 1 ug/ml to reveal nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were incubated with 4′,6-diamidino-2-phenylindole (Sigma-Aldrich) for 0.1 μg/ml for 5 min and then washed with PBS for three times (5 min each) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei are counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma), washed in PBST ...
-
bioRxiv - Microbiology 2021Quote: ... Borosilicate glass capillaries are loaded with a concentrated SARS-CoV-2 suspension previously coloured by the addition of 10% (V/V) of 0.5% phenol red in PBS (Sigma), then connected to a FemtoJet 4i microinjector (Eppendorf) ...
-
bioRxiv - Cell Biology 2020Quote: HA-GLUT4-mEos3.2 expressing cells were serum starved for 2 hours in live cell imaging media containing Dulbecco’s Modified Eagle’s Medium (DMEM) without phenol red (D5030; Sigma-Aldrich) and supplemented with 4500 mg/L D-glucose (G7528 ...
-
bioRxiv - Biochemistry 2023Quote: ... Ro 20-1724 [4-(3-butoxy-4-methoxy-benzyl) imidazolidone] was purchased from Sigma Aldrich (catalog no. B8279); stock concentrations were made at 100 mM in DMSO.
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the primers KLB163 (AGACGCGGCCGCCGCGGGAGTACTTTACGGG ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the KLB161 (AGACGCTAGCGAACTTTTTTCTTCTAATTTTTTGA ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA and Phenol Red (Sigma-Aldrich®) were mixed to obtain the final injection mix ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cas9 protein and Phenol Red (Sigma P0290) was assembled on ice and incubated at 37°C for 5 minutes to aid Cas9-gRNA ribonucleoprotein complex formation for more efficient mutagenesis ...
-
bioRxiv - Genomics 2019Quote: ... treatment and two sequential phenol/chloroform (Sigma) extractions ...
-
bioRxiv - Microbiology 2019Quote: ... and resuspended in 2% polyvinylpyrrolidone (PVP)40 (Sigma-Aldrich)/PBS containing 10% phenol red (Sigma-Aldrich) to aid visualisation of injections6.
-
bioRxiv - Microbiology 2019Quote: ... and 0,03 % phenol red (Sigma-Aldrich, USA). Mycoplasma were plated by a “cube” method as described above ...
-
bioRxiv - Immunology 2021Quote: ... 15.97 mg/L phenol red (Sigma-Aldrich) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Two consecutive phenol-chloroform (Sigma #P3803-100ML) extractions were performed and DNA was recovered by ethanol precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... and mannitol salt phenol-red agar (Sigma) for S ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phenol acid chloroform 5:1 (Sigma-Aldrich) and NaCl 10 mM were then added ...
-
bioRxiv - Bioengineering 2020Quote: ... in phenol red free media (Sigma, D5030). In the positive control group ...