Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 6 Isobutoxy 5 methylpyridine 3 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of 6-OHDA in 0.01% ascorbate (Sigma–Aldrich) into the median forebrain bundle (MFB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Peptides were extracted with 5% formic acid (Sigma F0507-1L), then 5% formic acid with 75% ACN ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5-aminolaevulinic acid (ALA) were all from Sigma-Aldrich, and their stocks were made fresh in water ...
-
bioRxiv - Neuroscience 2022Quote: ... decanoic acid (CID: 334-48-5; Millipore Sigma; Catalog #:21409), undecanoic acid (112-37-8 ...
-
bioRxiv - Genetics 2022Quote: ... 5’-dithiobis-nitrobenzoic acid (DTNB-Sigma Chemical Co., St Louis). The reaction mixture contained 100 mM Tris-HCl buffer (pH 7.8 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 mM N-methyl-DL-aspartic acid (NMA, Sigma-Aldrich), 10 – 20 mM Serotonin (5-HT ...
-
bioRxiv - Immunology 2020Quote: ... 5-(Tetradecyloxy)-2-furoic acid (TOFA) 5μg/mL (Sigma, T6575), Rotenone 1 μM (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 g/L aminocaproic acid (Sigma, A2 504-256-100G), penicillin/streptomycin] ...
-
bioRxiv - Neuroscience 2022Quote: (2R)-amino-5-phosphonovaleric acid (AP5) was obtained from Sigma/Research Biochemicals Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... Imaging buffer containing 5 mM 3,4-dihydroxybenzoic acid (P5630, Sigma), 2 mM trolox (238813 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg/mL L-ascorbic acid 2-phosphate (A7506, Sigma), 10-7 M dexamethasone (D2915 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were precipitated by adding 5-sulfosalicylic acid (Sigma-Aldrich) to a final concentration of 1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg/mL L- ascorbic acid 2-phosphate (A7506, Sigma), 10-7 M dexamethasone (D2915 ...
-
bioRxiv - Bioengineering 2023Quote: ... D-(–)-2-Amino-5-phosphonopentanoic Acid (D-APV, Sigma-Aldrich) 80 µM ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/mL 7-aminocephalosporanic acid (7-ACA) (Sigma-Aldrich), 5 µg/mL clavulanic acid (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μM L-azetidine-2-carboxylic acid (AZC) (Sigma #P8783) was added to the culture medium for 4 days.
-
bioRxiv - Neuroscience 2023Quote: ... DL-2-amino-5-phosphonopentanoic acid (APV; 50 μM; Sigma) and gabazine (10 μM ...
-
bioRxiv - Genomics 2019Quote: ... About 5×10^5 to 5×10^6 cells were crosslinked with final 1% formaldehyde (Sigma, F8775-500ML) for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... Fatty acids palmitic (4) and stearic acids (5) were sourced from Sigma-Aldrich (St. Louis, MO, USA). (± ...
-
bioRxiv - Plant Biology 2021Quote: ... L-1 of the internal standards salicylic acid-d 5 (SA-d5) and dehydrojasmonic acid (Sigma-Aldrich). Following extraction ...
-
bioRxiv - Plant Biology 2021Quote: ... L-1 of the internal standards salicylic acid-d 5 (SA-d5) and dehydrojasmonic acid (Sigma-Aldrich). Following extraction ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Genetics 2023Quote: ... 10-200 mg tissue was digested in 1 ml 3 N hydrochloric acid (Fisher)/10% trichloroacetic acid (Millipore Sigma) at 65 °C for two days ...
-
bioRxiv - Molecular Biology 2019Quote: The bands were visualized using an acid phosphatase-conjugated secondary antibody and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Sigma-Aldrich, St. Louis, USA) substrate system ...
-
bioRxiv - Neuroscience 2020Quote: ... 2.5 KCl, 25 NaHCO3, 1.25 NaH2PO4, 2.5 glucose, 6.2 MgCl2, 0.1 CaCl2, and 3 kynurenic acid; Sigma-Aldrich GmbH; bubbled with 95% 02 / 5% CO2) after intracardial perfusion with ice-cold ASCF ...
-
bioRxiv - Cell Biology 2021Quote: All the culture media contained 2.0 mg/mL 6-aminocaproic acid (Sigma-Aldrich, USA) and 1 mg/ml trans-4-aminomethyl cyclohexane carboxylic acid (TA ...
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... shoots were collected and homogenized in ice-cold 6% trichloroacetic acid (TCA) (Sigma Aldrich). In the supernatant ...
-
bioRxiv - Neuroscience 2022Quote: ... Imaging buffer containing 2 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox, Sigma), 5mM 3,4-Dihydroxybenzoic acid (DBA ...
-
bioRxiv - Cell Biology 2020Quote: ... Skeletal muscle cell growth media containing 1.5 mg/mL 6-aminocaproic acid (ACA; Sigma) was gently added to each channel and then to fill the well ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1 mM Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Sigma, Cat# 238813). The cultures were kept at 35 °C during the imaging procedure ...
-
bioRxiv - Neuroscience 2023Quote: ... delivering 1μl of 6-OHDA solution diluted in 0.02% ascorbic acid (Sigma-Aldrich, Hungary) with a speed of 1μl/min in either a low ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % antibiotic and 6-aminocaprioc acid at 1.5mg/mL (ACA, Sigma-Aldrich A2504-100G). Polymerized hydrogel containing iPSC-derived myogenic progenitors was immersed in 2 mL of F-10 medium (Wisent ...
-
bioRxiv - Biochemistry 2023Quote: ... Twelve mM Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma-Aldrich; 238813-1G) solution was prepared as described previously by adding 60 mg of Trolox powder (238813-5G ...
-
bioRxiv - Biophysics 2024Quote: ... Twelve mM Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma-Aldrich; 238813-1G) solution was prepared as described previously3 by adding 60 mg of Trolox (238813-5G ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...