Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 6 FLUORO 4 METHYLINDAN 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Neuroscience 2020Quote: ... Before injecting 6-hydroxydopamine (6-OHDA, Sigma), mice were first treated with a mix of desipramine (25 mg/kg ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-Aminonicotinamide (6-AN) 2 μM (SIGMA), S-(5′-Adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Developmental Biology 2023Quote: 6-Hydroxydopamine hydrochloride (6-OHDA) (Sigma, H4381)
-
bioRxiv - Microbiology 2021Quote: Fifty microliters containing 3.5 x 106 PFU/ml SARS-CoV-2 viral stock was placed on one well of a 4-well chambered glass slide (Nunc, Sigma) (Fig 2) ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-acetylated tubulin (6-11B-1; 1:1000 for IF; Cat#6793, Sigma), mouse monoclonal anti-glutamylated tubulin (B3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:800 mouse anti-acetylated tubulin (clone 6-11B-1, Millipore-Sigma, cat#: MABT868), 1:600 rabbit anti-FMRFamide (Immunostar ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse acetylated tubulin antibody was incubated at 1:1000 from Sigma (6-11B-1). Secondaries Alexa fluorophores anti-rabbit 488 and anti-mouse 647 were used at 1:1000 dilutions.
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:100 (Sigma Aldrich) and mouse polyclonal anti-PAR2 1:100 (T ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-acetylated α-tubulin clone 6-11B-1 1:2000 (Sigma Aldrich). Bound antibodies were detected using peroxidase-labeled anti-rabbit IgG (GE Healthcare) ...
-
bioRxiv - Zoology 2019Quote: Primary antibodies: mouse monoclonal 6-11B-1 for acetylated tubulin (diluted 1:1000; Sigma), mouse monoclonal 3C11 for synapsin (SYNORF1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Worms were transferred at the L4 larval stage to NGM plates containing 50 μM 5-fluoro-2’deoxyuridine (FUDR, Sigma). The day of the timed egg laying was considered day 0 for lifespan analysis.
-
bioRxiv - Bioengineering 2020Quote: ... A 2 mm by 2 mm piece of Kim wipe was soaked in 30% Fluoro-Ruby (FR; EMD Millipore, AG335) and placed inside the silicon nerve cuff toward the bottom ...
-
bioRxiv - Physiology 2023Quote: ... were transferred to OP50-seeded plates or RNAi-seeded NGM plates supplemented with 50 μM of 5-fluoro-2-deoxyuridine (FUDR, Sigma) to prevent progeny growth ...
-
bioRxiv - Neuroscience 2023Quote: ... gilal cell growth and proliferation was inhibited by treating the cell cultures with 50μM 5-fluoro-2-deoxyuridine (Sigma-Aldrich). Mature cultures were used at DIV 11-12 for experiments and contained more than 95% neurons.
-
bioRxiv - Neuroscience 2024Quote: ... One group of mice (referred to as DMI + 6-OHDA) was pre-treated with one injection of desipramine hydrochloride (DMI, Sigma-Aldrich, 25mg/kg i.p.) 30 minutes before the 6-OHDA infusion in order to protect the noradrenergic system [50].
-
bioRxiv - Microbiology 2019Quote: ... One tube of lysate was treated with 1 μL of trehalase (Sigma-Aldrich) enzyme or vehicle control ...
-
bioRxiv - Cell Biology 2022Quote: ... One 10 cm plate per condition was lysed 1 ml RIPA buffer (Sigma) and Halt Protease Inhibitor Cocktail (Thermo) ...
-
bioRxiv - Cancer Biology 2019Quote: ... One hour incubation in blocking solution containing 1% Bovine Serum Albumin (Sigma, A7906), 2% goat serum (Gibco ...
-
bioRxiv - Biophysics 2023Quote: ... 1% Triton X-100 and one EDTA-free protease inhibitor tablet (Sigma Aldrich) for 5 min on ice and then sonicated ...
-
bioRxiv - Genomics 2024Quote: ... One microgram of RNA was treated with 1 U of DNaseI (Sigma-Aldrich) following the manufacturer’s instructions for 15 min at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... followed by the addition of 1 uM 4-Hydroxytamoxifen (4-OHT; Sigma, SML1666), when required ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2.5 µM of 4-(4-Diethylaminostyryl-1-methyl-pyridinium-iodid (DiAsp, Sigma, D3418), which specifically labels hair cells in the lateral line in 0.5 % DMSO for 30 minutes35 ...
-
bioRxiv - Plant Biology 2021Quote: ... truncatula seedlings were transferred to Fahräeus medium supplemented with water (mock treatment) or 1 μM of 6-BAP (6-benzylaminopurine; Sigma-Aldrich) and maintained under the same growth conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were mounted in VectaShield containing 0.75 μg/ml 4-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich, D9542). Imaging was performed using a Zeiss Axio Observer Z1 microscope with AxioCam MRm Rev3 camera and ApoTome optical sectioning (Carl Zeiss ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were counterstained with 4′,6-Diamidino-2-phenylindole di-hydrochloride (DAPI, Sigma-Aldrich, St. Louis, MO, USA) diluted 1:3.000 in PBS ...
-
bioRxiv - Pathology 2021Quote: ... and then they were incubated with 100 ng/ml 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) in PBS before mounting with ImmunoSelect antifading mounting medium (Dianova) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were treated with PBS containing 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich, cat# D8417) for 20 min and mounted with cover glass using Fluorogel (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then treated with 4′,6-Diamidine-2′-phenylindole dihydrochloride at 15mM (DAPI, Sigma-Aldrich, Madrid, Spain) during 15 minutes at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... at RT and nuclear counterstaining was performed using 4’,6-diamidino-2-phenylindole (DAPI, 1.5 μg/mL; Sigma). After brief drying ...
-
bioRxiv - Neuroscience 2019Quote: Zebrafish 4-6 dpf larvae were immobilized right side up in 2% low melting point agarose (Sigma-Aldrich) on microscope slides ...
-
bioRxiv - Genomics 2019Quote: ... Cells were also labelled with a combination of 4′,6-diamidino-2-phenylindole or DAPI (Sigma, Cat #D9542) and Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by appropriate fluorescently conjugated secondary antibodies and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma, D9542). Primary antibodies used were against ...
-
bioRxiv - Microbiology 2021Quote: ... T13320), SYTOX green (0.25μM, Thermo, S7020) and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, 2μg/ml, Sigma, D9542). Staining was performed at ambient temperature for 20 minutes in the dark followed by a wash with 50μl PBS ...
-
bioRxiv - Immunology 2021Quote: ... in complete media containing 10 U/mL rhIL-2 with or without 10 or 20 uM 6-(4-Chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde O-(3,4-dichlorobenzyl)oxime (CITCO) (Sigma-Aldrich); an equal volume of DMSO served as the negative control.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Cancer Biology 2022Quote: ... Coverslips were lastly counterstained with DAPI (4′,6-diamidino-2-phenylindole) and mounted on slides using DABCO (Sigma). Cells were then viewed using a Nikon Ti2-E/A1R-Multiphoton microscope equipped with DS-Qi2 camera (Nikon).
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5 μM RA treatments on days 0 and 4 plus 10 nM BIO (6-Bromoindirubin-3’-oxime, Sigma) treatment on day 0 ...
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml).
-
bioRxiv - Microbiology 2022Quote: ... female 3–4-week-old BALB/c or C57BL/6 mice were injected intraperitoneally with 10mg azoxymethane (Sigma) per kg mouse weight ...