Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: ... tris(2-pyridylmethyl)amine (TPMA, Sigma-Aldrich, 98%), 2-hydroxyethyl 2-bromoisobutyrate (HEBIB ...
-
bioRxiv - Bioengineering 2021Quote: ... tris(2-pyridylmethyl)amine (TPMA, Sigma-Aldrich, 98%), Alkyne Tris(benzyltriazolylmethyl)amine (THPTA ...
-
bioRxiv - Bioengineering 2019Quote: ... The glass micropipettes were surface-modified through silanization with N-(2-aminoethyl)- 3-aminopropyltrimethoxysilane (EDA) (Sigma Aldrich catalog # 440302) in order to reduce stiction forces between polysilicon and the wall of the miniaturized glass micropipette during their integration ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was then labeled with the MDCC (7-Diethylamino-3-[N-(2-maleimidoethyl) carbamoyl]coumarin) from Sigma-Aldrich. Unreacted MDCC was removed by ion exchange using a Bio-Rex70 column ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were labeled with 25 µM 5-Chloro-2’-deoxyuridine (CldU, Sigma-Aldrich, CAS 50-90-8) for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by a second 20-minute pulse with 250 µM 5-chloro-2-deoxyuridine (C6891, Sigma-Aldrich). The labeled cells were then washed twice with ice-cold 1X PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were sequentially pulse-labeled with 50 μM of 5-chloro-2′-deoxyuridine thymidine (CldU) (Sigma-Aldrich) and 250 μM of idoxuridine (IdU ...
-
bioRxiv - Biophysics 2020Quote: ... ammoniumpersulfate and 0.1 % (v/v) N,N,N,N-tetramethylethylenediamine onto freshly plasma-cleaned cover slips that were treated with 3-aminopropyltriethoxysilane (Sigma, Munich, Germany, A3648) and subsequently with a 0.05% glutaraldehyde solution (Sigma ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) hexafluorophosphate azabenzotriazole tetramethyl uronium (HATU; 2 equiv:ELP amine, Sigma, 445460), and (3 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Plant Biology 2020Quote: ... plants were incubated overnight at 37°C in GUS buffer (3 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide [Duchefa Biochemie, Haarlem, The Netherlands], 0.1% v/v Triton X-100 [Sigma, Steinhaim ...
-
bioRxiv - Genetics 2020Quote: ... and the colour reaction was carried out with NBT/BCIP (4-nitroblue tetrazolium chloride/bromo-4-chloro-3-indolyl phosphate; Sigma). Sections were dehydrated and mounted with Vectamount (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6-thioguanine or N-methyl-N’-nitro-N-nitrosoguanidine (Sigma) were performed the next day for 24h before drug retrieval ...
-
bioRxiv - Systems Biology 2023Quote: ... Sections were then blocked for 1h with 3% (v/v) donkey serum (Sigma-Aldrich, St Louis, MO) diluted in TBS-T wash buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by addition of 1.12 g N-hydroxysuccinimide [9.72 mM] and 1.79 g of N-(3-(dimethylamino)propyl)-N’-ethylcarbodiimide hydrochloride [9.36 mM] (Sigma). The resulting solution was mixed at room temperature (RT °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 150,000 cells were stained with 10 μM 4’-(trimethylammonio)-diphenylhexatriene (TMA-DPH) or 2 μM Laurdan (6-dodecanoyl-N,N-dimethyl-2-naphthylamine; both obtained from Sigma-Aldrich) for 30 minutes at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: hMSC condensations (N = 3/group) were homogenized in TRI Reagent (Sigma-Aldrich) for subsequent total RNA extraction and cDNA synthesis (iScript™ kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Biotin 3-sulfo-N-hydroxysuccinimide ester (1 mg/mL; Sigma, Cat# B5161) was added for 30 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... N-(3- Oxohexanoyl)-L-homoserine lactone (AHL, K3007, Sigma-Aldrich, 25 mM), or caffeine (A10431.22 ...
-
bioRxiv - Pathology 2021Quote: ... N″-triacetylchitotrioside [4-MU-β-(GlucNAc)3] (Sigma, St. Louis, MO, USA) as the substrate ...
-
bioRxiv - Microbiology 2022Quote: ... N-butyryl-homoserine lactone (C4-HSL, Sigma-Aldrich CAS# 98426-48-3), and 2-Heptyl-3-hydroxy-4(1H)-quinolone (pqs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and n-(3-hydroxytetradecanoyl)-DL-homoserine lactone (C14-HSL, Sigma-Aldrich, #51481). For blue-white screening ...
-
bioRxiv - Cell Biology 2023Quote: N-[4-(7-diethylamino-4-methyl-3-coumarinyl)phenyl]maleimide (CPM, Sigma) was dissolved in DMSO at 4 mg/ml as stock solution and diluted 20 times using a buffer containing 25 mM HEPES ...
-
bioRxiv - Biophysics 2020Quote: Unsized unilamellar DOPG liposomes containing Laurdan (6-Dodecanoyl-N, N-dimethyl-2-naphthylamine, from Sigma, Taufkirchen, Germany) (molar ratio lipid:Laurdan=1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 50 μl of antibody exposed to hemin or hemin in PBS only were mixed with 150 μl of reaction buffer (0.15 M citrate-phosphate buffer pH 5) containing 0.9 mM of 2,2-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma-Aldrich) and 6 mM H2O2 ...