Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (Sigma-Aldrich) was used to stain nuclear DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 4’,6-diamidino-2- phenylindole (DAPI, Sigma, D9542) was diluted in the respective medium and added to the cultures at a final concentration of 10 ug/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) reagent and paraformaldehyde were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Cancer Biology 2023Quote: Cellular proliferation was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT; Sigma) assay and validated by viable cell counts.80
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability was assessed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Sigma-Aldrich). 10μl MTT (5 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...
-
bioRxiv - Microbiology 2023Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5 dimethylthiazol-2-tl)-2,3-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (STL, USA). Bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Cancer Biology 2024Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) for 4 hrs at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... Phalloidin and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma Aldrich. DMEM (Dulbecco’s Modified Eagle’s Medium) ...
-
bioRxiv - Biophysics 2021Quote: ... The primers used for the same were a) A350P forward 5’-gctgcatccggccgcatctcggc-3’ and b) A350P reverse 5’-gccgagatgcggccaaggatgcagc-3’ (Sigma Aldrich, India). Full length A350P was thereafter cloned into an empty pEGFP (Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... The signal was determined by nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (toluidine salt) (BCIP) (Sigma, 72091).Semithin sections for toluidine blue myelin staining and ultrathin section for TEM imaging were prepared according to our previous protocols (Zhang et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... at 60°C and developed using nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Sigma Aldrich) for 60 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... a 1:10,000 anti-rabbit dilution of IgG alkaline phosphatase was used before detection with NBP-BCIP (nitroblue tetrazolium chloride–5-bromo-4-chloro-3′-indolylphosphate; Sigma-Aldrich) as the substrate.
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of the DIG-labelled probes was carried out by using an anti-DIG antibody coupled with alkaline phosphatase and a ready-to-use 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro-blue tetrazolium (NBT) solution (Sigma-Aldrich) as the chromogenic substrate for the enzyme ...
-
bioRxiv - Developmental Biology 2020Quote: ... The staining reactions lasted between 2h and 8h at room temperature using nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3′-indolyphosphate (BCIP) staining reactions (Sigma Aldrich). Embryos were then rinsed in PBS-T (0.05% Tween-20) ...
-
bioRxiv - Plant Biology 2020Quote: ... and placed in Petri dishes filled with 0.5% agarose containing 35 mM β-mercaptoethanol (v/v) and 1.5 mg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Sigma). For X-gal staining ...
-
bioRxiv - Microbiology 2022Quote: ... Detection was performed by colorimetry using nitro blue tetrazolium chloride / 5-bromo-4-chloro-3-indolyl-phosphate (NBT-BCIP, Sigma-Aldrich) as a substrate.
-
bioRxiv - Cell Biology 2020Quote: ... and 3 μM CHIR99021 on 0.1% gelatin (Catalog No. ES-006-B, Millipore)-coated plates (for the 2i condition) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.1% amphotericin B 250 μg/mL solution (Sigma Aldrich, 1397-89-3). Each explant was adhered to the center of a 6-well culture plate (Corning ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated for 3 min with 0.1% (w/v) Sudan Black B (Sigma) in 70% ethanol ...
-
bioRxiv - Synthetic Biology 2023Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...