Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for 5 Isobutylcyclohexane 1 3 dione 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg mL−1 β-Casein (>98% pure, from bovine milk, Sigma-Aldrich) for surface passivation ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The larvae were then anesthetised with 0.04% MS-222 (Ethyl 3-aminobenzoate methane sulfonic acid salt 98%, Sigma Aldrich) and fixed in 4% PFA (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mg glass wool were filled with 200 µl (Z)-3-hexenyl acetate (HAC; >98%; Sigma-Aldrich, Buchs, Switzerland) diluted 50 fold in EtOH and sealed with screw caps containing a rubber septum ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Control anti-influenza viral agents amantadine hydrochloride (AMT; ≥98%) and ribavirin (RBV; ≥98%) were purchased from Sigma-Aldrich. Oseltamivir carboxylate (OSV-C ...
-
bioRxiv - Microbiology 2022Quote: ... stable isotope of 5-FU in diH2O (98 atom %15N, 99 atom %13C; empirical forumla: 13CC3H3F15N2O2; Millipore Sigma) that acted as an internal standard for 5-FU quantitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... ≥98% was obtained from Sigma-Aldrich (S6951). Because Surfen binds avidly to plastic ...
-
bioRxiv - Neuroscience 2020Quote: ISRIB (> 98% purity) was from Sigma-Aldrich. Aβ1-42 was purchased from California Peptide ...
-
bioRxiv - Microbiology 2019Quote: ... or L-citrulline (Sigma-Aldrich, 98% purity). The pH of the supplemented and un-supplemented FCJM was adjusted to 4.7 ± 0.1 or 3.7 ± 0.1 as indicated in the text using a 5N NaOH solution (Spectrum Chemicals ...
-
bioRxiv - Plant Biology 2019Quote: ... and trans-2-hexenal 98%) (Sigma-Aldrich). Two terpene representatives were the sesquiterpene β-caryophyllene 97% (CAS ...
-
bioRxiv - Bioengineering 2019Quote: ... 98% ≥ L-tryptophan (Sigma-Aldrich, T0254-5G) and L-Kynurenine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... enterobactin (Escherichia coli) (Sigma-Aldrich, USA, ≥98%); and deferrioxamine E (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... 2,5-Dihydroxybenzoic acid 98% (DHB) (Sigma Aldrich), Norharmane 98% (Nor ...
-
bioRxiv - Microbiology 2022Quote: ... Analytical-grade ≥98% cyanocobalamin (Sigma Aldrich; V2876) was dissolved in MilliQ water standard (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.5 μM CuSO4 (7758-98-7, Sigma), 0.01 μM CoCl2 (7646-79-9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100mM PMSF (329-98-6; Sigma-Aldrich) in isopropanol (190764-4x4l ...
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 µm 6,7-Dinitroquinoxaline-2,3(1H,4H)-dione (DNQX, Sigma-Aldrich, D0540) were used to isolate mEPSCs or mIPSCs ...
-
bioRxiv - Bioengineering 2023Quote: ... The neuromodulators used are 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX, Sigma-Aldrich) 50 µM ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... University of Malaya (Kuala Lumpur, Malaysia). 4-Nitroquinoline 1-oxide (4NQO) (Cas. No: 56-57-5, ≥98% purity) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Stock solution of BK3C231 at 100mM and 4NQO at 25mg/mL were prepared by dissolving the compounds in solvent dimethyl sulfoxide (DMSO ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
bioRxiv - Biochemistry 2020Quote: ... L-aspartic-15N acid (98 atom% 15N) and (D3)-L-methionine (98 atom% D) were obtained from Sigma-Aldrich. Isotopically labeled 13C6-glucose (≥99 atom% 13C ...
-
bioRxiv - Microbiology 2020Quote: Lopinavir (SML1222, purity ≥ 98 %), ritonavir (SML0491, purity ≥ 98 %), and (−)-Epigallocatechin gallate (EGCG) (E4134, purity ≥ 95 %) were purchased from Sigma- Aldrich (Saint Louis ...
-
bioRxiv - Bioengineering 2024Quote: ... 2- (dodecylthiocarbonothioylthio)-2-methylpropionic acid (DDMAT, 98%), 2,2’-azobis(2- methylpropionitrile) (AIBN, 98%) and N, N-dimethylformamide (DMF, ≥99.8%) are purchased from Sigma Aldrich and used as received.
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Bioengineering 2022Quote: ... Then a 5 mL bolus of 0.8 M 13C sodium bicarbonate (98 atom % 13C, 99% purity, Sigma-Aldrich, USA) was injected into the flask at time t=0 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... purity 98%), deferoxamine mesylate (DFX; D9533, purity 92.5%) and dexamethasone (DEX; D4902, Lot 112K12845, purity 98 %) were obtained from Sigma-Aldrich. TCDD (RPE-029 ...
-
bioRxiv - Plant Biology 2021Quote: ... Reagents including heavy isotopes were purchased from Sigma 5% 2H2O supplemented solutions were made up v/v with 99.9% deuterium oxide while 15N solutions contained K15NO3 98% and 15NH415NO3 98% obtained from Sigma Aldrich.
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS, 840035), and β-casein from bovine milk (>98% pure, C6905) were purchased from Sigma. BODIPY-TR-C5-ceramide ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... marimastat (>98% HPLC, Cat no: M2699, Sigma-Aldrich), and prinomastat hydrochloride (≥95% HPLC ...
-
bioRxiv - Plant Biology 2019Quote: ... and 1.9 g/L K15NO3 (98% 15N Sigma) (Sigma Aldrich 335134) ...
-
bioRxiv - Biochemistry 2022Quote: ... zinc (II) chloride (ZnCl2, ≥98%, Sigma-Aldrich, USA) and an iron (III ...
-
bioRxiv - Microbiology 2019Quote: Taurolithocholic acid was purchased from Sigma Aldrich (≥98%). A 0.5 M stock solution was made by dissolving TLCA in methanol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... tris(2-pyridylmethyl)amine (TPMA, Sigma-Aldrich, 98%), 2-hydroxyethyl 2-bromoisobutyrate (HEBIB ...
-
bioRxiv - Biophysics 2019Quote: ... and 2.5 mg of azobisisobutyronitrile (98%, Sigma-Aldrich) was then added to initiate the reaction ...