Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for 3 methy 5 isobutylhydantion since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 0.2% methy-cellulose (Sigma) and oxygen-scavenging (2 mM DTT ...
-
bioRxiv - Cancer Biology 2023Quote: ... including vehicle (Methy cellulose w/v 0.5%, Cat# B6385, Sigma-Aldrich, and tween 80 v/v 0.1% ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’-GACAUAUUUGAUAAACUUAAA-3’, 5’-GUUAUCAGUCUGAGCCAGG-3’), human DRP1 (5’-GCAGAAGAAUGGGGUAAAU-3’, 5’-UCCGUGAUGAGUAUGCUUU-3’, 5’-GAGGUUAUUGAACGACUCA-3’) non-targeting scrambled siRNA (Sigma, SIC001-1NMOL) for 48-72 hours using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Tspan12 siRNA duplexes (#1: 5’-GCUUAUCUUUGCCUUCUCCTT-3’ and 5’-GGAGAAGGCAAAGAUAAGCTT-3’; #2: 5’-AUGAGGGACUACCUAAAUATT-3’ and 5’-UAUUUAGGUAGUCCCUCAUTT-3’) (Sigma) using Lipofectamine RNAiMax (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Cancer Biology 2021Quote: ... MYC forward 5’-TGAGGAGGAACAACAAGATG-3’ and reverse 5’-ATCCAGACTCTGACCTTTTG-3’ and GAPDH forward 5’-CTTTTGCGTCGCCAG-3’ and reverse 5’-TTGATGGCAACAATATCCA-3’) (Sigma-Aldrich), the Radian SYBR Green Lo-ROX qPCR Kit (Alkali Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequences of forward and reverse primers for εGLT (fw: 5′-CTGTCCAGGAACCCGACAGA-3′; rev: 5′-TGCA GCAGCGGGTCAAG-3′) and γ1GLT (fw: 5’-CCAGGGCAGGGTCAGCA-3’; rev: 5’-GGTGCTCTTGGAGGAGGGT-3’) (Sigma-Aldrich) and their corresponding FAM-labelled MGB probes (εGLT ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg of Arixtra was added to 10 volumes (w/w) of N-Methy-N-(trimethylsilyl)-trifluoroacetamide (MTSTFA, Sigma, ≥98.5%) and 100 volumes (v/w ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... including vehicle (Methy cellulose w/v 0.5%, Cat# B6385, Sigma-Aldrich, and tween 80 v/v 0.1%, Cat# P4780, Sigma-Aldrich, to 1x PBS), MBQ-167 alone ...
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...