Labshake search
Citations for Millipore Sigma :
4901 - 4950 of 10000+ citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 4 mM L-glutamate (Sigma Aldrich), 100 U/ml penicillin G ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 mM L-glutamate (Sigma Aldrich), 100 U/ml penicillin G ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 4% β -mercaptoethanol (Sigma Aldrich) were added to the lysed samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 mM L-glutamine (Sigma-Aldrich), penicillin (100 U/ml) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4-methylcyclohexanol (4MCH; Sigma-Aldrich), for 1 minute in a constant air flow with or without reward with an interval of 1 minute between the two odor presentations ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mM NaHCO3 (Sigma-Aldrich S5761), and 20% FBS (Biotechne ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human interleukin-2 (IL-2) (H7041) was purchased from Sigma Aldrich. Ficoll-PaqueTM PLUS (17-1440-02 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) hexafluorophosphate azabenzotriazole tetramethyl uronium (HATU; 2 equiv:ELP amine, Sigma, 445460), and (3 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mM penicillin/streptomycin and 2 mM L-glutamine (Sigma, UK). Hek-293T cells were plated in 24 well plates for 24 hours before transduction with LV-LTα or LV-GFP at MOI 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μM ponatinib (Selleckchem) or 2 μM iodoacetamide (IAA) (Sigma-Aldrich), the other half was treated with vehicle (DMSO or water ...
-
bioRxiv - Microbiology 2020Quote: ... 2% glycerol or 2% casamino acids and in RPMI-1640 (Sigma, containing L-glutamine ...
-
bioRxiv - Microbiology 2022Quote: ... E2 and P4 were solubilized in 2-butanol (2-BtOH; Sigma) as our previous studies demonstrate that this reagent does not interfere with NgPLD activity ...
-
bioRxiv - Biochemistry 2019Quote: 2 µl of 1 mM 2’,7’ Dichlorofluorescein diacetate (Sigma-Aldrich) dissolved in DMSO was added to 198 µl of cell culture in a black f-bottom 96 well plate (Greiner bio-one ...
-
bioRxiv - Immunology 2019Quote: ... and recombinant human interleukin-2 (rhIL-2; 25U/ml; Sigma-Aldrich). To mimic a transient stimulation ...
-
bioRxiv - Biochemistry 2019Quote: ... Released glycans were labelled with 2-aminobenzamide (2-AB; Sigma-Aldrich) and purified on Whatman 3 mm chromatography paper ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 25mM Hepes (N-[2-hydroxyethyl]piperazine-N0-[2-ethanesulfonic acid; Sigma]), supplemented with 10% heat inactivated FBS (GIBCO ...
-
bioRxiv - Immunology 2020Quote: 2-deoxy-d-glucose (2-DG; Sigma-Aldrich, St. Louis, MO) treatment of wounded zebrafish larvae (simple tail transection ...
-
bioRxiv - Neuroscience 2022Quote: 2-Bromopalmitate (or 2-bromohexadecanoic acid, Sigma-Aldrich, Cat no. 238422) was dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... 2% pectone (Difco) and 2% glucose (Sigma-Aldrich, Carlsbad, CA, USA) or selective medium YNB containing ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 µg/ml doxycycline and 2 µM Ara-C (Sigma-Aldrich). From day 3 – 6 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mm samples were embedded instead in 2% agarose (Sigma-Aldrich) in 0.15 M CaC or in water (depending on the last staining step that the sample was exposed to ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 mM N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (Sigma H0887), 100 U/ml penicillin and 100 μg/ml streptomycin (Sigma P4333 ...
-
bioRxiv - Cell Biology 2024Quote: ... and drugs (2-deoxy-d-glucose (2-DG, SIGMA, 1 mM), N-acetylcysteine (NAC ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 μM ISG65 or 2 μM bovine serum albumin (Sigma) were combined in phosphate buffered saline pH 7.4 ...
-
bioRxiv - Microbiology 2024Quote: ... 12.5 mM 2-oxoglutarate (2-OG, Sigma-Aldrich, St. Louis, Missouri), pH 8.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 2-Deoxy-D-Glucose (2-DG; D8375; Sigma; 10 mM), as stated.
-
bioRxiv - Immunology 2022Quote: ... followed by clearing/mounting using 2’-2’-thio-diethanol (Sigma, 166782) as previously described6 ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 mM potassium hexacyanoferrate(II) trihydrate (C6FeK3N6+2 · 3H2O; Sigma Aldrich), 2 mM potassium hexacyanoferrate(III ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2-deoxy-D-glucose (2-DG) (50 mM) (Sigma Aldrich). When stated ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2% FBS and 2% antibiotic antimycotic solution (Sigma-Aldrich).
-
bioRxiv - Zoology 2023Quote: ... Each egg-sperm bundle was placed in a 2 mL microcentrifuge tube and allowed to break up in 0.1 mL of seawater and for the eggs to hydrate for 2 hrs before preserved in zinc fixative (1:4 Z-fix, Sigma-Aldrich Inc. to 0.2 µm filtered seawater FSW). Preserved eggs from each bundle were photographed using an Olympus SZX7 dissecting microscope equipped with an Olympus America camera (SN ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...