Labshake search
Citations for Millipore Sigma :
4851 - 4900 of 10000+ citations for Recombinant Human PDCD5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... muscle whole-cell protein lysates were diluted in MPER buffer (Sigma-Aldrich) supplemented with protease and phosphatase inhibitor cocktails ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... BAL cytokines were profiled using a pre-mixed MILLIPLEX protein immunoassay (Millipore) that was read on a Bio-Plex 200 multiplex suspension array system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... after which the proteins were transferred to Immobilon P membranes (Merck Millipore). After blocking the membrane with 5% skimmed milk in TBS-T buffer solution for 1 h at RT or overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... purified Rv1019 protein (200μg) was emulsified in TitreMax Gold adjuvant (Sigma-Aldrich) and used to immunize two one-year old male rabbits by subcutaneous injection ...
-
bioRxiv - Microbiology 2020Quote: ... Fractions containing the desired protein were concentrated (Amicon Ultracel 100 K, Millipore) and further purified by size-exclusion chromatography (SEC ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were transferred onto an Immobilon P membrane (Millipore, Burlington, Massachusetts, USA) using TRANS-BLOT SD SEMI DRY TRANSFER CELL (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 protein was detected with rabbit anti-LAMP1 (Sigma, Cat# SAB3500285) and horseradish peroxidase-conjugated mouse anti-rabbit (Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... the protein was overexpressed in Rosetta (DE3) pLysS E.coli cells (Millipore Sigma) and grown in Terrific Broth (TB ...
-
bioRxiv - Developmental Biology 2020Quote: ... We used 10µl G-protein coupled Sepharose beads per IP (SIGMA, P3296). Anti-Myc IPs were performed with 10µl Anti-Myc-Agarose bead (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting protein was concentrated by Amicon Ultra centrifugal filter (Millipore). The sample was diluted to 2.5 μg/ml and analyzed on a glycan 100 binding array provided by Creative Biochip ...
-
bioRxiv - Biophysics 2019Quote: ... Protein complex was concentrated with Amicon® Ultra Centrifugal Filters (Merck Millipore) and further purified on a Superdex 200 10/300 GL size-exclusion column (GE Healthcare ...
-
bioRxiv - Pathology 2020Quote: Dissolve proteins and FITCs in FluoroTag™ FITC Conjugation Kit(Sigma-Aldrich)kit buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were concentrated by ultrafiltration using Amicon Ultra centrifugal filters (Merck Millipore) with respective molecular weight cut offs ...
-
bioRxiv - Biochemistry 2019Quote: ... Strep-II-tagged proteins were bound to Strep-Tactin resin (EMD Millipore), washed with lysis buffer ...
-
bioRxiv - Genetics 2019Quote: ... Immunoprecipitated DNA was purified using 30 μl of protein A beads (Sigma), which were washed prior to DNA elution and cross-link reversal as previously described [16 ...
-
bioRxiv - Plant Biology 2019Quote: ... and salmon sperm DNA/protein A agarose beads (Millipore, Billerica, MA, USA) were used for ChIP experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... The IMAC fractions containing the protein were concentrated by ultrafiltration (Amicon, Millipore) and then injected onto a Superdex 200 10/300 FPLC column (GE Healthcare ...
-
bioRxiv - Physiology 2020Quote: ... and protein bands were detected using Ponceau S staining solution (Sigma, P7170).
-
bioRxiv - Molecular Biology 2021Quote: ... Protein G Dynabeads were pre-equilibrated with mouse anti-FLAG antibody (Sigma) and added to clarified extract for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... 2.5 µl 5000x SPYRO Orange protein gel stain (Sigma-Aldrich catalog #S5692) to 1977.5 µl of buffer (20 mM MOPS ...
-
bioRxiv - Cell Biology 2019Quote: ... BCA assay reagents used for protein estimation were purchased from Sigma-Aldrich, ...
-
bioRxiv - Biochemistry 2021Quote: The solubilized protein was then loaded on a DEAE CL-6B (Sigma) column ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was applied to column packed with ATP-agarose (Sigma Aldrich) and the column was washed with buffer A (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were transferred to low fluorescence PVDF membrane (Millpore Sigma cat. # IPFL00010). REVERT total protein stain was used to detect and quantify transferred proteins ...
-
bioRxiv - Biochemistry 2021Quote: ... and equal amount of protein was subjected to benzonase nuclease (Millipore Sigma) treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were transferred to a PVDF membrane (Merck Millipore cat. No. IPFL00010) after which the membrane was blocked using Odyssey Blocking buffer (PBS ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... The separated proteins were transferred onto PVDF membrane (Millipore, Billerica, Massachusetts, USA) using phosphate-based transfer buffer (10 mM sodium phosphate monobasic ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-microtubule-associated protein 2 (MAP2) Alexa 555 (1:500, MAB3418A5; Millipore), antimicrotubule-associated protein 2 (MAP2 ...
-
bioRxiv - Physiology 2021Quote: ... The protein peak was collected and 20μM of iodoacetamide (Sigma-Aldrich; I1149) was added to the solution ...
-
bioRxiv - Bioengineering 2021Quote: ... the protein bands were developed using an enhanced chemiluminescent detection kit (Millipore). The optical bands were visualized in a Fuji Las-3000 dark box (FujiFilm) ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... We used 50 mg of Protein-A-Sepharose beads (Sigma, P3391-1G), resuspended beads in 1 ml ChIP-buffer (1.1% Triton X-100 ...
-
bioRxiv - Cell Biology 2019Quote: Purified proteins in indicated concentrations were incubated with fluorescently labelled ssODN (Sigma) (0.25μM-6-FAM-39mer-5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were then alkylated by the addition of 10 mM iodoacetamide (Sigma) for 15 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins and antigens were wet-transferred in TGS 1X (Sigma T7777-1L) with methanol 20% to a nitrocellulose membrane (Amersham 10600004 ...
-
bioRxiv - Genetics 2021Quote: ... The eluted protein was concentrated with Amicon Ultra 50 Kda filters (Millipore) and loaded into a Superdex 200 10/300 size-exclusion column (Cytiva ...
-
bioRxiv - Immunology 2020Quote: ... Proteins were loaded onto Polyvinylidene difluoride (PVDF) membranes (Millipore, Temecula, CA, USA) in buffer containing 10% Tris-glycine and 15% methanol ...
-
bioRxiv - Microbiology 2020Quote: ... and probed with protein-specific antisera against 3xFLAG (Sigma-Aldrich, cat# F1804), 6xHis (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: RIP was performed by Magna RIP RNA binding protein immunoprecipitation kit (Millipore). A549 cells were lysed into RIP lysis buffer ...
-
bioRxiv - Immunology 2021Quote: ... these mice were challenged by injection of 50 µg ova protein (Sigma) into the hind paw ...
-
bioRxiv - Immunology 2021Quote: ... Non-specific protein was blocked with 2 % normal donkey serum (Sigma Aldrich) in PBS containing 0.05 % Tween-20 and 1 % BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were transferred to an Immobilon-P Transfer Membrane (EMD Millipore) by wet-blotting ON at 4°C at 25 V ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein product was concentrated with a centrifugal filter unit (MD Millipore) and concentration determined by Bradford staining against a BSA standard ...
-
bioRxiv - Molecular Biology 2020Quote: ... The protein solution was concentrated on 10 kDa MWCO filter (Amicon-Millipore) and further purified on size exclusion column Superdex 200 in lysis buffer where β-mercaptoethanol was replaced with 1 mM TCEP ...
-
bioRxiv - Immunology 2021Quote: ... The purified proteins were validated by EZBlue™ Gel Staining (G1041, Sigma) or immunoblotting.
-
bioRxiv - Immunology 2020Quote: ... The purified protein content was measured by Bradford assay (B6916, Sigma-Aldrich) and analyzed under reducing conditions with 12% SDS-PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: The eluted protein was concentrated using Amicon Ultra-centrifugal filters-50K (Millipore). The concentrated sample was further purified by gel filtration on HiLoad 16/600 Superdex200 column (GE Healthcare ...
-
bioRxiv - Microbiology 2019Quote: ... Protein quantification was performed using the Direct Detect® system (Merck-Millipore). Each sample was set to 40 µg of total protein in 100 µl in 100 mM TEAB ...
-
bioRxiv - Neuroscience 2021Quote: ... protein extracts were applied to 30kDa MWCO centrifugal filter units (Microcon, Millipore), mixed with UA buffer (8M urea ...
-
bioRxiv - Neuroscience 2020Quote: ... the target proteins were detected by an enhanced chemoluminescence reagent (ECL, Millipore) with an image acquisition system (Biostep ...
-
bioRxiv - Microbiology 2020Quote: ... The protein pellet was solublized with NuPAGE Sample Buffer + 5% BME (Sigma) and run on a 10-12% Bis-Tris MOPS gel (Thermo) ...