Labshake search
Citations for Millipore Sigma :
4801 - 4850 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in running tap water for 5 min and stained in Biebrich Scarlet-Acid Fucsin for 5 min (#HT151, Sigma). Sections were rinsed in de-ionized water and re-fixed in freshly made Phosphomolybdic/Phosphotungstic/dH2O (1:1:2 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then labeled for 5 hours at 4C in 50 μL HBSS with 5 mg/mL bovine serum albumin (BSA, Sigma) with 10 μg/mL wheat-germ agglutinin (WGA ...
-
bioRxiv - Microbiology 2022Quote: ... Metabolite sample (5 μL) was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 μm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5- or 5-μl volume of ice-cold extracts were spotted along the bottom of polyethyleneimine-cellulose TLC plates (Millipore). The spots were air dried ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were blocked in blocking buffer (5% non-fat milk or 5% FBS diluted in TBS-T buffer (0.05% Tween-20 (Sigma-Aldrich) in tris-buffered saline (TBS) ...
-
bioRxiv - Neuroscience 2020Quote: ... the iN cells were dissociated with Accutase and replated with mouse glia cells on Matrigel-coated coverslips in 24-well plate (150k cells/well) in Neurobasal 1% serum medium containing 5 μM 5-fluorodexoyuridine (FUDR, Sigma) and 4 μM Uridine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Superovulation was induced in 4- to 16 week-old female mice by i.p injection of 5 IU of pregnant mare serum gonadotropin (5 IU, PMSG; EMD Millipore) at 14:30 and 48 hours later with 5 IU of human chorionic gonadotropin (5 IU ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Physiology 2020Quote: ... was dissolved in vehicle solution containing 5% dimethyl sulfoxide (Scharlab, Sentmenat, Spain) and 5% cremophor EL (Sigma-Aldrich, Steinheim, Germany) in sterilized water and filtered with a 0.22 µm filter (Millex GP ...
-
bioRxiv - Cell Biology 2020Quote: ... The labelling media was replaced with growth factor deprived MCF10A culture media containing 5 mM L-cysteine and 5 mM L-methionine (Sigma) for indicated times ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked on a 5% dry nonfat milk solution or 5% BSA with Tris-buffered saline (TBS) with 0.1% TWEEN® 20 (Sigma) at room temperature for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Genetics 2021Quote: ... were superovulated by serial Pregnant Mare Serum Gonadotropin (5 IU per mouse, Prospec Protein Specialists) and human chorionic gonadotropin (5 IU, Millipore) injections 46 h apart ...
-
bioRxiv - Microbiology 2020Quote: ... schizont stage parasites enriched from 5-10 mL of culture at 5-10% parasitemia were treated with 0.15% saponin (Sigma Aldrich) and protease inhibitor (Cat ...
-
bioRxiv - Genomics 2020Quote: ... An additional 5 μg/mL αF was then added at the same time as 5 μg/mL CPT (Sigma-Aldrich). The cells were pelleted for DNA extraction 2.5 h after adding the CPT ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Physiology 2023Quote: ... Samples were blocked for three hours at room temperature in blocking solution [5% normal goat serum (MP Biochemicals) plus 5% bovine serum albumin (Sigma) in PBST] and then incubated overnight at 4°C in primary antibodies diluted in blocking solution ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... primary and secondary antibody incubations were done in TBS-T (Roth, 1061.1) supplemented with 5% milk powder (Heirler, 4010318030305) or 5% BSA (Sigma, A7906). Blots were blocked for 1h at RT and primary antibody was added over night at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... were mixed with ssDNA output oligonucleotides of interest at 2x excess (Table S1) in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 mice (5 male and 5 female) received a single daily injection of BrdU (150 mg/kg, i.p.; Sigma B5002) 1 month after infusion ...
-
bioRxiv - Biophysics 2024Quote: ... the blots were blocked with Tris-buffered saline with 0.1% Tween-20 detergent (TBST) + 5% milk and probed using TBST + 5% milk with anti-FLAG (ANTI-FLAG(R) M2-Peroxidase (HRP) by Sigma) or anti-His6X (His HRP conjugate by Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Developmental Biology 2024Quote: Total ATP content in a pool of 5 oocytes was determined using the Adenosine 5′-triphosphate (ATP) bioluminescent somatic cell assay kit (FLASC, Sigma) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the cultures were washed in cold PBS then the cells were scrape harvested in 300 μL 5% 5-sulfosalicylic acid (Sigma) in water and stored at -20°C for a maximum of 72 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant (5 μl) was injected onto a ZIC-pHILIC 150 × 2.1 mm (5-μm particle size) column (EMD Millipore) connected to a Thermo Vanquish ultrahigh-pressure liquid chromatography (UPLC ...
-
bioRxiv - Neuroscience 2023Quote: mice received an intraplantar injection of 20 μl of 5% formalin diluted from formaldehyde solution (5% v/v from 37% stock formaldehyde solution (Sigma)) in sterile saline ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were rinsed in water three times before a 5 min bath of 5% Sodium Thiosulfate (Sigma Aldrich, catalog #S7026).
-
bioRxiv - Immunology 2023Quote: ... B cells (seeded at 5 x 105 / mL) were cultured with 5 µg/mL LPS (Sigma-Aldrich, St Louis, MO), 10 ng/mL BAFF (AdipoGen ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Biophysics 2023Quote: ... dissolved in Tris buffer (5 mM TRIS, 5 mM NaCl, 20 mM MgCl2, pH 7.5 (all chemicals from Sigma-Aldrich)
-
bioRxiv - Bioengineering 2023Quote: ... The gels were then washed with wash buffer three times for 5 min followed by permeabilization and blocking in 5% BSA (Sigma), 1% Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were blocked using 5% BSA or 5% non-fat dried milk in TBS containing 0.05% Tween 20 (Sigma-Aldrich) for 1h at 15-25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... rapamycin was diluted in a vehicle solution that contained 5% Tween 80 and 5% PEG 400 (low-molecular-weight grade of polyethylene glycol; Sigma) and injected intraperitoneally (i.p. ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Microbiology 2022Quote: ... GW4869 (0-100 μM), Trichostatin A (TSA, 0-100 nM), RG108 (0-100 nM), or 5-Azacytidine (5-AC, 0-50μM) (SIGMA, USA). The effect of drug treatment on the parasites was monitored by infecting human fibroblasts with KU80-GFP bradyzoites or RH-YFP tachyzoites (70 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS for 5 min at RT and incubated with 5% bovine serum albumin (BSA, Sigma-Aldrich, St. Louis, MO) for 1h at RT ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 male and 5 female mice received a unilateral intraplantar injection of CFA (10uL, F5881, Sigma Chemical, St. Louis, MO). Mechanical paw withdrawal thresholds were collected prior to CFA injection ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were rinsed 3X (5 min each) in tris-buffered saline (TBS) and blocked in 5% normal goat serum (catalog #G9023, Millipore) for 1h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Sections were developed for 5 min in DAB solution (3,3’diaminobenzidine; 5 mg/ml DAB, 0.1M PB, 0.000036% H2O2; Sigma-Aldrich D-5637). Acute neuronal loss in the CA1 region of the hippocampus was quantified as described previously2.
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...