Labshake search
Citations for Millipore Sigma :
4701 - 4750 of 5739 citations for Heme Assay Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitation of m6A-modified transcripts was carried out with Magna MeRIP™ m6A Kit (Merck-Millipore, 17-10499) following the manual ...
-
bioRxiv - Genetics 2022Quote: The amplification of the whole mtDNA was performed with the Expand™ Long Range dNTPack kit (Sigma Aldrich) according to Fendt et al ...
-
bioRxiv - Immunology 2022Quote: ... The reaction was revealed with 3,3′-diaminobenzidine Substrate Kit for Peroxidase and fast blue substrate (both Sigma-Aldrich, St ...
-
bioRxiv - Bioengineering 2022Quote: ... we cultured T-SLICE in the presence of 100 μM of the EF5 Hypoxia Detection Kit (Sigma-Aldrich). Cell culture media was supplemented with 100 μM EF5 incorporated into the media for 6 ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA was extracted using Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, United States) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...
-
bioRxiv - Genomics 2022Quote: ... Single nuclei from fetal brain were isolated using Pure Prep Nuclei Isolation kit (Sigma, St. Louis, MO, USA) as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Full length CDS of DvCHR was labelled with the DIG RNA Labeling Kit (Sigma-Aldrich, St. Louis, USA). The probe was hybridized to the membrane at 50 °C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from freshly ground tissue using the Spectrum™ Plant Total RNA Kit (Sigma Aldrich). RNA samples were used to generate sequence libraries using a library prep kit from New England Biolabs (NEB #E7530) ...
-
bioRxiv - Microbiology 2022Quote: Serum cytokines were determined using a custom premixed Milliplex Map porcine cytokine/chemokine magnetic beads kit (Millipore, USA) for 13 cytokines i.e ...
-
bioRxiv - Molecular Biology 2023Quote: ... MSK-QRESS-KIT] and 1μL was injected into a ZIC-pHILIC 150 × 2.1mm (5μm particle size) column (EMD Millipore) operated on a Vanquish™ Flex UHPLC Systems (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Actin RNA and viral RNA were measured using the KAPA SYBR fast universal qPCR kit (Sigma-Aldrich, US) on the QuantStudio real-time PCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: Digoxygenin (DIG)-labeled probes were produced with the SuperScriptTM III One-Step RT-PCR kit (Sigma 12574-026) using specific primers for the Bgl-FaNaC transcript (Forward ...
-
bioRxiv - Physiology 2023Quote: ... 8µl of plasma was used to determine NEFAs concentration using the Free Fatty Acid Quantitation Kit (Sigma: MAK044) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA from 50 mg FW sporophytes was isolated with the Spectrum Plant Total RNA Kit (Sigma-Aldrich) applying protocol B ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Snap frozen lungs were homogenized and nuclear extracts were obtained using the CelLyticTM NuCLEARTM Extraction Kit (Millipore-Sigma). Protein concentrations were determined by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and fruits of three replicate were isolated by using RaFlex Total RNA isolation Kit (Merck Millipore, Massachusetts, USA) by following the standard protocol defined by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... or MG132 using a MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-based in vitro toxicology kit (TOX1-1KT, Sigma). 10 µl MTT solution was applied to cells at the end point of the experiment and incubated for 4 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Congo red staining was performed using a Congo red amyloid stain kit procedure (Sigma Aldrich, St Louis, MO). Pathological tau was evidenced with CP13 (1/50 ...
-
bioRxiv - Neuroscience 2024Quote: Cell viability was measured using the cell counting kit-8 (CCK-8) (Sigma-Aldrich, St. Louis, MO, USA) as previously described 104 ...
-
bioRxiv - Immunology 2024Quote: Plasma aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were assessed using kits from Sigma-Aldrich (St. Louis, MO), and IL-1β was assessed using a kit from R&D systems (Minneapolis ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were extracted from the residue debris pellets and quantified using a BCA kit (Sigma-Aldrich, Taufkirchen, Germany). Lipid profiling was performed using a Sciex ExionLC AD coupled to a Sciex ZenoTOF 7600 under control of Sciex OS 3.0 (Sciex ...
-
bioRxiv - Molecular Biology 2024Quote: ... Blue Dextran from the Gel Filtration Molecular Weight Markers Kit for Molecular Weights 29,000–700,000 Da (Sigma Aldrich) was used as a void volume marker and the six proteins (Albumin ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells were incubated with anti-mouse minus and anti-rabbit plus PLA probes (PLA kit from Sigma) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Each cell line was tested monthly for mycoplasma using the Lookout Mycoplasma PCR detection kit (Sigma-Aldrich, # MP0035) and confirmed mycoplasma free ...
-
bioRxiv - Neuroscience 2024Quote: ... Upper layer was used for TG measurement using Serum Triglyceride Determination kit (TR0100, Sigma Aldrich, Saint Louis, USA). Serum leptin was measured with Mouse Leptin ELISA KIT #90030 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mice DNA was extracted from ear notches or tails using the RED ExtractN-Amp Tissue PCR Kit (SIGMA). For Lrp1flox ...
-
bioRxiv - Cell Biology 2023Quote: ... All constructs were prepared for transfection using either the GenElute HP Endotoxin-Free Plasmid Maxiprep Kit (Sigma-Aldrich) or the NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL) ...
-
bioRxiv - Cell Biology 2023Quote: ... All constructs were prepared for transfection using either the GenElute HP Endotoxin-Free Plasmid Maxiprep Kit (Sigma-Aldrich) or NucleoBond Xtra Midi EF kit (MACHEREY-NAGEL).
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl of Alexa Fluor 488 click reaction cocktail (Click-iT Plus EdU Flow Cytometry Kit; Sigma C10633) was added for 30 minutes in the dark at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... we extracted total RNA with the GenElute™ Mammalian Total RNA Miniprep Kit (#RTN350-1KT, Sigma Aldrich, USA). For both RNA-Seq and WGBS ...
-
bioRxiv - Developmental Biology 2024Quote: The concentration of TGs in embryos was measured using the Triglyceride Quantification Colorimetric Kit from Sigma (Cat. #MAK266). 50 stage5 embryos were homogenized in Eppendorf tubes on a Nonidet P40 Substitute (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse genotypes were determined by PCR using genomic DNA extracted using the REDExtract-N-Amp kit (Sigma XNAT) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... and full blooming flowers (i.e. petals were fully unfolded) using the Spectrum Plant Total RNA Kit (Sigma Aldrich) and generated 80.00 million PE 150-bp reads (Illumina NovaSeq ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were inspected for mycoplasma contamination using a VenorTM GeM Mycoplasma Detection kit PCR-based (Sigma, MP0025-1KT).
-
bioRxiv - Biochemistry 2024Quote: ... The cell lines were tested for mycoplasma contamination using the LookOut® Mycoplasma PCR Detection Kit (Sigma Millipore) and were found to be negative for mycoplasma.
-
bioRxiv - Biochemistry 2024Quote: ... The cell lines were tested for mycoplasma contamination using the LookOut® Mycoplasma PCR Detection Kit (Sigma Millipore) and were found to be negative for mycoplasma.
-
bioRxiv - Cell Biology 2024Quote: ... the invaded cells were fixed and stained with a Harleco Hemacolor staining kit (EMD Millipore, Oakville, ON, Canada). The non-invaded cells remaining at the top of the membrane were removed with a cotton swab ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from cryopreserved patient tissue samples using GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 1 million cells in triplicates using GenElute Mammalian Total RNA Miniprep Kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the GenElute PCR Clean-up kit (Sigma Aldrich, St. Louis, MO, USA) according to instruction manual ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and three stages of development of the floral head) using a Spectrum Plant Total RNA Kit (Sigma, USA) with on-column DNA digestion following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were confirmed to be negative for mycoplasma using LookOut® Mycoplasma PCR Detection Kit (Sigma-Aldrich, MP0035).
-
bioRxiv - Microbiology 2023Quote: ... All pCC2Fos replicons were extracted using the GenEluteTM HP Plasmid Miniprep Kit (Sigma Aldrich, St. Louis, Missouri, USA) and NucleoBond® Xtra Midi Plus (MACHEREY-NAGEL ...
-
bioRxiv - Microbiology 2022Quote: ... the presence of Fucα1-2Gal-R was detected with a TMB (3,3’,5,5’-tetramethylbenzidine) kit (Sigma-Aldrich, USA), and the signal intensities [the optical density at 450 nm (OD450)] were read with a Multiskan Sky plate reader (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Samples extracted with Direct-zol RNA miniprep kit were disrupted by vortexing with glass beads (Sigma-Aldrich #Z250465) for 5 minutes in TRI reagent ...
-
bioRxiv - Cancer Biology 2023Quote: The Duolink in situ PLA was performed using Duolink In Situ Red Starter Kit Mouse/Rabbit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: Mouse High Sensitivity T Cell Magnetic Bead kits were purchased from EMD Millipore (MHSTCMAG-70KPMX, Burlington, MA, USA) and used to quantify 18 different mouse cytokines in accordance with the manufacturer’s recommendations (belonging to 4 main categories ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR data shown in figures 3B and S3B was done using the Spectrum RNA extraction kit (Sigma-Aldrich), followed by DNase treatment using AMPD1 DNase I (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Jurkat were tested every six months for mycoplasma contamination using the LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) according to the manufacturer’s instructions (Fig ...