Labshake search
Citations for Millipore Sigma :
401 - 450 of 2498 citations for Rat TRPV1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... or control non-target MISSION control shRNA (available through Sigma). MDA-231 and BT-549 cells were modified with NLS-RFP (pCDH-CMV-3xNLS-TagRFP-T-EF1-blastiSBT-549 [30] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were infected with MISSION® shRNA lentiviruses (Sigma-Aldrich) designed for the human PRKCA gene (TRCN0000196730 ...
-
bioRxiv - Cancer Biology 2022Quote: shRNA targeting murine Map3k7 was purchased from Sigma-Aldrich (TRCN0000022563). A pLKO.1-puro Non-Target shRNA was used as control ...
-
bioRxiv - Cancer Biology 2020Quote: Four different mission shRNAs from the TRC1 library (Sigma-Aldrich, TRCN0000019174 ...
-
bioRxiv - Microbiology 2022Quote: NOD2 MISSION shRNA Lentiviral Transduction Particles from Sigma Aldrich (TRCN0000066813) were used to stably down-regulate NOD2 in J774 macrophage ...
-
bioRxiv - Cancer Biology 2022Quote: ... pCMV-VSV-G and shRNA-encoding lentiviral vectors (Sigma-Aldrich) into HEK293T cells with Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cDNA and shRNA expression were induced by Doxycycline (Sigma, D9891) at concentrations ranging from 0.1 to 1.0 μg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral constructs expressing shRNAs directed against SLFN11 (Sigma TRCN, TRCN0000152057) or a non-targeting control shRNA (TRCN0000231489 ...
-
bioRxiv - Cell Biology 2021Quote: ... The shRNA-containing lentiviral vectors were purchased from Sigma Aldrich.
-
bioRxiv - Microbiology 2022Quote: ... shRNA is in TRC2-pLKO-puro vector (SHC201 Sigma-Aldrich) background with puromycin as a mammalian selection marker ...
-
bioRxiv - Molecular Biology 2022Quote: Non-target scrambled shRNA (SHC002) was purchased from Sigma Aldrich. shRNA to human raptor (plasmid#1857 ...
-
bioRxiv - Cancer Biology 2022Quote: MLL1 was depleted using two separate shRNA constructs (Millipore Sigma):
-
bioRxiv - Neuroscience 2022Quote: ... and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Microbiology 2022Quote: The shRNAs targeting human MARCHF8 were purchased from Sigma-Aldrich. The sgRNAs targeting mouse Marchf8 were designed by the web-based software ChopChop (http://chopchop.cbu.uib.no ...
-
bioRxiv - Genomics 2022Quote: We purchased lentiviral shRNA-expressing constructs targeting Twist2 (Millipore Sigma clone IDs TRCN0000086084 ...
-
bioRxiv - Cell Biology 2023Quote: ... The knockdown efficiencies of shRNAs were provided by Sigma-Aldrich using quantitative PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... MISSION pLKO.1 scrambled non-target shRNA SHC002 (Millipore Sigma) was used as a control for SNX17 knockdown constructs ...
-
bioRxiv - Biochemistry 2023Quote: MISSION TRC1.5 pLKO.1-puro Non-Mammalian shRNA Control (Sigma) was used as a control shRNA.
-
bioRxiv - Developmental Biology 2023Quote: ... The Mouse Ulk4 shRNA lentiviral vector was purchased from Sigma (TRCN0000328268 for Ulk4 knockdown in NIH3T3 cells and MEFs;TRCN0000002203 for Ulk4 knockdown in HEK293 cells) ...
-
bioRxiv - Biochemistry 2023Quote: ... or the pLKO.1-shRNA vector (Sigma Mission TRCN0000001418; ‘shDDR2’) using LipofectamineTM 2000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... pLKO.1 (Mission shRNA library from Sigma-Aldrich, see below), and the packaging vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... TDP43-specific shRNA lentiviral clone (clone ID TRCN000016038, Sigma Aldrich) or SHC001 (shRNA Empty Vector Control Plasmid DNA) ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentiviruses expressing shGAN and shSCR have been described previously and were obtained from SIGMA MISSION shRNA systems: shGAN (MISSION® vector TRC # TRCN0000251146, Sigma) and shSCR (#SHC002 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Immunology 2019Quote: shRNA’s were acquired from the Mission library (Sigma, Zwijndrecht, the Netherlands) and were kindly provided by (dept ...
-
bioRxiv - Neuroscience 2020Quote: ... The following lentiviruses were used for transduction: Mission shRNA vectors (Sigma) shNT (Non-Mammalian shRNA Control ...
-
bioRxiv - Cancer Biology 2020Quote: Validated siRNAs and lentiviral constructs expressing shRNAs were purchased from Sigma. Constructs for CRISPR/Cas9-mediated gene knockout (Cas9 and guide RNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... FOXO3A (TRNC0000010335, only clone validated by Sigma MISSION shRNAs, to date) and control (SHC002) ...
-
bioRxiv - Cancer Biology 2022Quote: Suppression of ABL1 was achieved using lentivirus-based shRNAs (Sigma Aldrich). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: shRNAs targeting ABCG2 were obtained from Sigma-Aldrich (product# SHCLNG-NM_004827). Viral supernatants were prepared by transfecting 293T cells with GFP- or ABCG-targeting shRNAs encoded in pLKO.1 vectors using X-tremeGENE 360 transfection reagent (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... The vectors encoding two different shRNAs targeting ERK5 were from Sigma (TRCN0000010262/pLKO.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A non-targeting shRNA (# SHC202) was also purchased from Sigma-Aldrich.
-
bioRxiv - Cell Biology 2020Quote: ... MDN1 and mouse Prmt1 were the validated MISSION shRNAs (Sigma-Aldrich). The shRNAs were TRCN0000290479 (human PRMT1) ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S3). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...
-
bioRxiv - Cancer Biology 2021Quote: shRNAs targeting the genes of interest were purchased from Sigma-Aldrich, including shRNAs targeting S100A11 (TRCN0000289926) ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S2). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 lentiviral constructs with shRNA was obtained from Sigma-Aldrich (MFN2-sh1:TRCN0000082684 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two different shRNAs for GMPS were used in this study (Sigma), shGMPS-41 ...
-
bioRxiv - Cell Biology 2022Quote: ... and with the indicated shRNA in the pLKO.1 vector (Sigma) using calcium phosphate precipitation ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1 lentiviral constructs with shRNAs were obtained from Sigma-Aldrich (shROCK ...
-
bioRxiv - Microbiology 2022Quote: ... BUD23 specific shRNAs or ORF11-GFP were treated with cycloheximide (Sigma) at 100 μg/ml for 3 min at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Induction of the shRNA was performed with doxycycline hyclate (Sigma Aldrich) at 2 µg/mL for 72 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... TFEB (TRCN0000013109; TRCN0000013108) and HSPA5 (TRCN0000001024) shRNAs were purchased from Millipore-Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... shRNA expression was induced using 1 µg/mL doxycycline (Sigma, D9891) for 72 h before seeding ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID: TRCN0000255746) and cloned into the pLKO.5-puro lentiviral construct (Sigma SHC201) ...
-
bioRxiv - Developmental Biology 2023Quote: ... non-targeting shRNA control (shCtrl: SHC016) were purchased from Sigma-Aldrich. Tetracyclin (Tet ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1-puro-shRNAs-Vectors for Control (Sigma-Aldrich, #TRCN0000382379), LSD2 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were transduced with lentivirus of MISSION TRC1-shRNA (Sigma) knocking down candidate substrates at DIV4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg of an shRNA vector (pLKO.1-puro vector-Sigma), 2 µg pMD2.g ...