Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for C C Motif Chemokine Ligand 23 CCL23 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... mouse mAb anti-c-myc (9E10, Sigma), rabbit anti-FLAG (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 50 μM vitamin C (Sigma-Aldrich). Fresh media was supplemented every alternate day ...
-
bioRxiv - Cell Biology 2019Quote: ... (B) CAGCAGUAGAUGCAUCUUACA[dTdT] and (C) SASI_Hs01_00169803 (Sigma). Cells were reverse transfected with siRNA using RNAiMax (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated with Ara-C (Sigma) at a final concentration of 5 µM to prevent the overgrowth of non-neuronal cells ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 μg/μL Poly(C) RNA (Sigma), 0.1 µg/µL bovine serum albumine and 0.5 U/μl RNasin (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... 100ng/mL cholera toxin (Sigma #C-8052), and 2mM L-Glutamine (Corning #25-005-CI) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mitomycin C (MMC) was purchased from Sigma and Olaparib was purchased from Selleckchem.
-
bioRxiv - Neuroscience 2020Quote: ... cytochrome C (0.3 mg/mL; Sigma-Aldrich), catalase (0.2 mg/mL ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.5 μg/μL Poly(C) RNA (Sigma), 0.5 μg/μL bovine serum albumin and 0.5 U/μl RNasin (Promega)) ...
-
bioRxiv - Cell Biology 2021Quote: ... AraC was purchased from Sigma (C-6645), diluted in PBS and used at concentration of 10μM for elimination of glia cells in the neuronal cultures ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2mM L-glutamine (Millipore, TMS-002-C), 1x penicillin/streptomycin (Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... c-Myc (Sigma PLA0001 or Roche 11667149001), Histone 3 (Sigma H0164) ...
-
bioRxiv - Biophysics 2022Quote: ... pH 7.4 at 25 °C (Sigma P3619). The solution was introduced through the microchannel and the current recorded for 5 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 24 hours of mitomycin C (Sigma) addition ...
-
bioRxiv - Systems Biology 2022Quote: ... 100ng/mL cholera toxin (Sigma #C-8052), and 2mM L-Glutamine (Corning #25-005-CI) ...
-
bioRxiv - Molecular Biology 2022Quote: ... mitomycin C (MMC, Sigma-Aldrich, 150 nM), Talazoparib (BMN 673 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.09 mM cytochrome C (Millipore Sigma C2506), and 1.4 μM catalase (Millipore Sigma C1345 ...
-
bioRxiv - Cell Biology 2022Quote: ... 35 mg/ml catalase (Sigma; C-40), 9 mg/ml b-D-glucose ...
-
bioRxiv - Microbiology 2023Quote: ... or 10 × MIC mitomycin C (Sigma Aldrich), and incubated at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... dissolved in corn oil (Sigma C-8267) was delivered to mice at 8-week old through i.p injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Cytosine-D-Arabinoside 0.54LmM (Sigma, C-1768) was added to cultures four days after plating ...
-
bioRxiv - Microbiology 2023Quote: ... Compound C (CC; Millipore Sigma or MedChemExpress) was purchased in solution at a concentration of 10 mM in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and vitamin C (0.25mM) (Sigma-Aldrich, A4544). To promote final differentiation towards the PP stage ...
-
bioRxiv - Biochemistry 2023Quote: ... 50 μg/mL vitamin C (Sigma-Aldrich), 10 nM vitamin D3 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 mM CaCl2 (Sigma-Aldrich #C-3306), 50 μg/mL DNAse I (Roche Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... Cytosine arabinose (Ara C, Sigma, catalog #: C6645) was added at a final concentration of 4 µM from DPI 5 (day-post-infection).
-
bioRxiv - Physiology 2023Quote: ... cytochrome c (CytC, 2µM;Sigma-Aldrich, C7752) was used ...
-
bioRxiv - Microbiology 2023Quote: ... cytochrome C from horse heart (Sigma-Aldrich), gentamycin (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tenascin C (1:300, Sigma-Aldrich #T3413), Dusp6 (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... ARA-C (1.2 µM; Sigma Aldrich, C1768) was added to curtail astrocyte proliferation ...
-
bioRxiv - Neuroscience 2023Quote: ... and Compound C (#US1171261 1MG, EMD Millipore). This combined with a CDM containing IMDM (#21980 065 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0,5% casein (Sigma, Cat. no. C-8654), 0,025% Tween (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... and adipogenic differentiation medium (Sigma, C-28016) following the manufacturers’ instructions.
-
bioRxiv - Neuroscience 2023Quote: ... c-myc (Sigma, Cat#M4439, 1:500), GFP (Abcam ...
-
bioRxiv - Genomics 2024Quote: ... at 37°C with RNase A (Millipore) prior to phenol/chloroform extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mg/mL casein (Sigma C-7078), and biotinylated microtubule seeds at a concentration that resulted in approximately 10 seeds per 90 x 90 µm2 field of view ...
-
bioRxiv - Microbiology 2024Quote: ... 400 µg/mL mitomycin C (Millipore Sigma) stock solution was prepared in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... SP-C (rabbit, Millipore-Sigma, cat# AB3786), Keratin5 (rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... SP-C (rabbit, Millipore-Sigma, cat# AB3786), Keratin5 (rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.2 g/ml cytochrome c (Sigma-Aldrich) and 0.5 mg/ml diaminobenzidine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... TDP-43 (rabbit polyclonal C-terminal, Sigma); FUS (mouse monoclonal ...
-
bioRxiv - Cell Biology 2024Quote: ... TDP-43 (rabbit polyclonal, C-terminal, Sigma); eIF2α (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2024Quote: ... with cytosine arabinoside (ara-C; Sigma #C6645) added to a working concentration of 2 μM to prevent glia overgrowth ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 μg/mL Mitomycin C (Sigma) to limit cell proliferation ...
-
bioRxiv - Neuroscience 2019Quote: ... and slices were incubated overnight at 4 °C in a PBST-based antibody carrier solution containing 3% normal goat serum and rabbit anti-TPH2 primary antibodies (Millipore, ABN60) diluted 1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... on BBS2 as described above and immunoblotted with the c-Myc antibody for BBS2 and with the anti-Flag antibody (Sigma F3165) for BBS7 and BBS9 also as described above.
-
bioRxiv - Neuroscience 2020Quote: ... followed by primary antibody incubation in 10% sheep serum at 4°C for 3 days (Anti-SCN5A antibody produced in rabbit (Sigma SAB2107930) 1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an overnight exposure at 4 °C in the same buffer to the following primary antibodies: (a) rabbit anti-mCherry polyclonal antibody (1:5000, Millipore #AB356482); (b ...
-
bioRxiv - Cancer Biology 2019Quote: ... the membranes were incubated overnight at 4 °C with primary antibodies: mouse monoclonal antibody against α-actinin (1:1,000; Millipore, MAB1682), mouse monoclonal antibody against G6PD (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... the membrane was then incubated overnight at 4°C with primary antibodies: 1∶15000 rabbit anti-V5 antibody (SIGMA, Cat. # V8137), and 1:12000 mouse anti-α-Tubulin antibody (SIGMA ...