Labshake search
Citations for Millipore Sigma :
401 - 450 of 7907 citations for 7α 12α Dihydroxy 5β cholestan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... treated for one minute with 2 mg/ml collagenase (Sigma-Aldrich) and mounted on a piece of Sylgard placed at the bottom of a Petri dish ...
-
bioRxiv - Genetics 2020Quote: ... After one wash in ice-cold calcium-free Schneider’s medium (Sigma), the pellet was resuspended in calcium-free Schneider’s medium containing 0.25% trypsin (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... to which one drop of Fluoroshield™ with DAPI (Millipore Sigma) was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... Fixative one: ice cold 0.2% glutaraldehyde (stock: 25%, Sigma-Aldrich; G5882), 4% paraformaldehyde (stock ...
-
bioRxiv - Neuroscience 2022Quote: ... One series of brain tissue was stained with cresyl violet (Sigma). Lesion volume was quantified using ImageJ (NIH ...
-
bioRxiv - Microbiology 2023Quote: ... Thirty-one (31) g/L of polyvinylpyrrolidone (PVP) polymer (Sigma, 437190) mixed with 0.9 g/L of sodium phosphate dibasic anhydrous Na2HPO4 (Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... oil mixture was prepared using one part castor oil (S259853, Sigma) to four parts of sunflower oil (S5007 ...
-
bioRxiv - Cell Biology 2023Quote: ... All actin was stabilized with one molar equivalent of phalloidin (Sigma). Steady-state ...
-
bioRxiv - Cell Biology 2023Quote: ... One quarter was washed two times with PBS (P4417, Sigma-Aldrich) to remove remaining medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by one-hour incubation with 1% Pluronic F127 (Sigma, P2443).
-
bioRxiv - Cell Biology 2023Quote: ... the medium was replaced by fresh one and cytochalasin B (Sigma) was added at 4 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... and transferred at 110mV for one hour to PVDF membranes (Millipore). Membranes were blocked with 5% milk for 1 hour and incubated at 4°C overnight with one or more primary antibodies in 2% bovine serum albumin ...
-
bioRxiv - Plant Biology 2023Quote: ... per 50 mL of buffer and one tablet of phosSTOP (Sigma) per 20 mL of buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... a second one with β-estradiol (2 μM; Sigma-Aldrich, E8875) for the induction of HO endonuclease 43 ...
-
bioRxiv - Cell Biology 2023Quote: ... with one Roche EDTA-free protease inhibitor tablet (11697498001; Sigma Aldrich) per ∼4 g cell pellet ...
-
bioRxiv - Cell Biology 2023Quote: ... of which one was incubated with choline chloride (Sigma-Aldrich, C7527) at a final concentration of 1 mM for 30 min on ice before concentrating to a protein concentration of 6 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... One and a half microgram anti-flag antibody (Sigma-Aldrich, F1804), nonspecific mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... One and a half microgram anti-flag antibody (Sigma-Aldrich, F1804), nonspecific mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Bioengineering 2024Quote: ... Amicon Ultra-0.5 (PLBC Ultracel-3 membrane, 3 kDa) and Amicon® Ultra-15 Centrifugal Filters (3 kDa MWCO) were from Millipore (Tokyo, Japan). Calcofluor-white and imidazole were from Sigma-Aldrich (Tokyo ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine 3 (NC, Sigma-Aldrich) was used as a control of transfection efficiency.
-
bioRxiv - Developmental Biology 2021Quote: ... 3-bromopyruvate (Sigma Aldrich #16490) or 2-deoxy-D-glucose (CARLROTH #CN96.3 ...
-
bioRxiv - Developmental Biology 2021Quote: The drug 3’-dA (Sigma) was dissolved in M16 medium (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked with 3% BSA (Sigma) in PBS for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 3×FLAG peptide (F4799, Sigma), Expi29™ expression medium (A1435101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 min (3–18, Sigma) after homogenization by a 5 ml glass-glass douncer (Braun ...
-
bioRxiv - Molecular Biology 2021Quote: ... also containing 3% BSA (Sigma) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Benzonase (Millipore, 70746-3). The lysates were homogenized by sonication and centrifuged for 1 h ...
-
bioRxiv - Genetics 2019Quote: ... and 3 nM TTNPB (Sigma). Day 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 mM MgCl2 (Sigma-Aldrich), 0.7 % Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 mM CHIR99021 (GSK3i, Sigma), and 1000 units/mL LIF (Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3% BSA (Sigma-Aldrich, A3311), and 0.2% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM MgCl2 (208337, Sigma) and 2 mM EGTA (E3889 ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 kDa cut-off (Millipore).
-
bioRxiv - Biochemistry 2021Quote: ... 3 kDa cut-off (Millipore).