Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 4’,6-diamidino-2-phenylindole (DAPI)(Sigma-Aldrich) added to the second wash at to a concentration of 300 nM to counterstain DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma) and acquired using LSR IV flow cytometer machine 20–21 ...
-
bioRxiv - Bioengineering 2021Quote: ... The DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) fluroscence staining was employed for visualizing nuclei ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-amino-4-hydroxy-6-methylpyrimidine (Sigma, Cat.# A58003) (10 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) was added to the cell suspension ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, USA). Slides were mounted in Mowiol 4-88 (Calbiochem ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma) was used to show nuclei clear and dyed for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... and 4’,6’-diamidino-2-phenylindole (DAPI) (Sigma, D9542). For immunofluorescence staining primary antibodies were anti-ACE2 (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, #D9542) and DRAQ5 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich D9542).
-
bioRxiv - Cell Biology 2022Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) at 1 µg/ml at RT for 45 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.2% DAPI (4’, 6-diamino-2-phenylindole; Sigma).
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6′-diamidino-2-phenylindole (1:3000; Sigma-Aldrich) was used to counterstain sections and coverslips were mounted using Fluorogel l (Electron Microscopy Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4′,6-diamidino-2 phenylindole (DAPI, Sigma-Aldrich) (1:2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich, cat# D9542 ...
-
Cyborg islets: implanted flexible electronics reveal principles of human islet electrical maturationbioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, D9542, Sigma-Aldrich) was added and stained for 1 day ...
-
bioRxiv - Bioengineering 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, D9542), Hoechst stain (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mg of 4-OHT (Sigma H7904) were dissolved in 120μl of ethanol ...
-
bioRxiv - Immunology 2022Quote: ... We used 3-4 synthetic sgRNAs (Sigma) per gene ...
-
bioRxiv - Microbiology 2023Quote: ... 4-azidobenzoic acid (6427-66-3, Sigma), propidium iodide powder (25535-16-4 ...
-
bioRxiv - Plant Biology 2020Quote: ... PGM buffer (6% mannitol, 3% sucrose, M5524 MS salts (Sigma), M7150 vitamins (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg/ml insulin (#I9278) and 2 × 10−11 M liothyronine (all Sigma-Aldrich, #T6397). HEK293T cells (a gift from Noor Gammoh ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse Tubulin (clone B-5-1-2 from Sigma, 1:5000), rabbit ZW10 (ab21582 from abcam ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-alpha tubulin mAb (clone B-5-1-2; Sigma-Aldrich) and sheep anti-NGF pAb (EMD Millipore ...
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... injected daily with 5 mg/kg body weight ethyl-2-[6-(4-chlorophenoxy)hexyl]-oxirane-2-carboxylate (etomoxir) (Sigma-Aldrich, US), dissolved in 5% (2-Hydroxypropyl)-β-cyclodextrin solution from day 8 following tumor transplantation (LLC-Eto) ...
-
bioRxiv - Neuroscience 2019Quote: ... whole brains of females (n = 6) were fixed in 4% PFA and embedded in 5% agarose (Type IX-A; Sigma-Aldrich) supplemented with 20% sucrose ...
-
bioRxiv - Microbiology 2020Quote: ... was used diluted at 4 μg/mL in PBS and incubated for 30 min with 5 μg/mL 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS to stain nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cryosections were then counterstained (5 min) with 0.5 µg/ml 4’,6’-diamino-2-phenylindole (DAPI; Sigma-Aldrich® Cat#D9542) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... counter-stained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 minutes at room temperature and mounted with Fluoroshield (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were washed in PBS and stained with 5 µg/ml 4′,6-Diamidino-2- phenylindole (DAPI) (D9564-10MG, Sigma-Aldrich) in 1xPBS+0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 6; MgCl2, 4; CaCl2, 5; sucrose, 160; glucose, 25; Hepes, 10; pH 6.7, 500 mOsmol; all chemicals from Sigma-Aldrich, France), to avoid desiccation of the brain surface ...
-
bioRxiv - Developmental Biology 2023Quote: ... nuclei and actin were stained in PBST containing 5 µg/ml 4′,6-diamidino-2– phenylindole dihydrochloride (DAPI; D9542, Sigma-Aldrich) and Alexa Fluor 488 phalloidin (diluted in 1/100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SCC-9 and SCC-4 (human tongue OSCC) cell lines were obtained from Sigma Aldrich, sourced from European collection of authenticated cell culture ...
-
bioRxiv - Immunology 2021Quote: ... 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (BCIP /NBT) liquid substrates for AP-enzyme (SIGMA) were added for overnight incubation at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 40ul of 20mg/mL X-gal (5-bromo-4-chloro-3-indolyl-β-D-galacto-pyranoside – Sigma Aldrich B44252) and 40ul of 100mM IPTG (isopropyl β-D-1-thiogalactopyranoside – AppliChem A4773 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...
-
bioRxiv - Biophysics 2019Quote: ... The eluate was incubated for 3 h at 4°C with 5 mL of FLAG M2 Agarose beads (Sigma), collected in a glass column ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 250 µL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) (20 mg/ml) (Sigma-Aldrich, UK) and Isopropyl ß-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell disruption was carried out by vortexing (3 cycles, 5 min each) at 4°C using 0.2 ml of glass beads (425-600 μm; Sigma). For the Rpb3 immunopurification ...
-
bioRxiv - Cell Biology 2022Quote: ... was revealed with 5-bromo-4-chloro-3-indolyl β-D galactoside (X-gal) (Sigma-Aldrich, Carlsbad, CA, USA). Diploid cells were grown on SC medium supplemented with 20 mg/L adenine hemisulfate ...