Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 2' 3' Dimethyl 3 2 5 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, 28718-90-3, St Louis, MO, USA). The results were recorded using Zeiss LSM780 confocal system (Zeiss ...
-
bioRxiv - Biophysics 2020Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, p# M5655, Sigma-Aldrich) was dissolved in Phosphate Buffer Solution (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by incubation in a solution of 2/3 dichloromethane (DCM; Sigma-Aldrich), 1/3 MetOH ...
-
bioRxiv - Molecular Biology 2023Quote: ... fed every day and split every 2-3 days using Accutase (A6964, Sigma).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: The MTT compound (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) was dissolved in RPMI 1640 without phenol red ...
-
bioRxiv - Molecular Biology 2022Quote: ... growth medium was supplemented with 100 μM of 2′,3′-dideoxycytidine (Sigma; D5782) or 50 ng/ml of ethidium bromide ...
-
bioRxiv - Neuroscience 2022Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail 2, Phosphatase Inhibitor Cocktail 3, Sigma-Aldrich), and then incubated for 1 hour on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... Phosphatase inhibitor cocktail 2 (#P5726) and cocktail 3 (P0044) were from Sigma-Aldrich. Glutathione Sepharose 4B (#17-0756-01 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 to 3 million cells were cross-linked using 1% formaldehyde (Sigma, F8775) for 10 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Cancer Biology 2022Quote: ... the reagent 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) was added to the cells and incubated for 4 hours at 37 °C (5 % CO2) ...
-
bioRxiv - Neuroscience 2022Quote: ... buffered with 3 mM N-2-hydroxyethylpiperazine-N’-ethanesulfonic acid (HEPES, Sigma Chemical) and pH adjusted to 7.65 at 15°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: Rosetta-gami 2 competent cells (Novagen / Millipore-Sigma, USA; cat. no. 71350-3)
-
bioRxiv - Biochemistry 2023Quote: Rosetta-gami 2 competent cells (Novagen / Millipore-Sigma, USA; cat. no. 71350-3)
-
bioRxiv - Neuroscience 2023Quote: ... The animals received unilateral injections totalling 3×2 μg of 6-OHDA (Sigma Chemical CO ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% each phosphatase inhibitor cocktails 2 and 3 (Sigma Cat #P5726 and P0044). Lysates were cleared at 17,000g ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor Cocktails 2 and 3 were from Sigma Aldrich (St. Louis, MO). Mouse anti-Rac1 antibodies (#ARC03) ...
-
bioRxiv - Molecular Biology 2024Quote: ... fed every day and split every 2-3 days using Accutase (A6964, Sigma).
-
bioRxiv - Molecular Biology 2024Quote: ... phosphatase inhibitor cocktails 2 and 3 (100uL/10mL, Sigma Cat #P5726 and P0044)) and lysates were cleared by centrifugation at 17,000g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO, USA) to prevent degradation of the protein of interest ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland). The insoluble fraction was then sonicated using a fine probe 15 times at 0.5 sec pulse at an amplitude of 20% ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 mM EDTA) supplemented with phosphatase inhibitor cocktail 2 and 3 (Sigma), and protease inhibitor cocktail (cOmplete Protease Inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... CRANAD-2 stock was dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich AG). The binding in vitro between CRANAD-2 (100 nM ...
-
bioRxiv - Immunology 2024Quote: ... Metabolites/pharmaceutical compounds used: Dimethyl 2-oxo-glutarate (Sigma-Aldritch 349631-5G), Glucosamine (Sigma-Aldrich G1514-100G) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Biochemistry 2022Quote: ... by plating them on NB agar medium (2% glucose, Ade, Ura) supplemented with different concentrations (5-50mM) of 3-aminotriazole (3AT; Sigma-Aldrich) histidine inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... 6-Bromo-4-((dimethylamino)methyl)-5-hydroxy-1-methyl-2-((phenylthio)methyl)-1H-Indole-3-carboxylic acid ethyl ester monohydrochloride (Arbidol) (Sigma Aldrich) was dissolved in ethanol at 10mg/ml and diluted to target concentration in infection media.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were then treated for 15 min up to 4 h at 37°C with 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma Aldrich, #M5655-1G) in 5 mM PBS ...
-
bioRxiv - Microbiology 2020Quote: ... were passaged 2-3 times weekly and grown at 37° C with 5% CO2 in DMEM containing 10 mM L-glutamine (Sigma, M8537), supplemented with 10% heat-inactivated FBS (HyClone) ...
-
bioRxiv - Microbiology 2021Quote: ... or the same isosmotic solution with 100 µM of the general anion channel inhibitor 5-Nitro-2-(3-phenylpropylamino) benzoic acid (NPPB, Sigma-Aldrich), which inhibits malarial new permeation pathways (59) ...
-
bioRxiv - Microbiology 2023Quote: Cross-linking experiments were performed by incubation of 2 mM and 5 mM of suberic-bis-acid ester (3-sulfo-N-hydroxyuccinimy (BS3, Sigma-Aldrich) with the purified recombinant protein in 25 mM sodium phosphate pH 7.4 for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... Flash-frozen plant samples (0.2 g) were ground and extracted using 2 mL of 3 % 5-sulfosalicylic acid (Sigma, ON, Canada). The extract was centrifuged for 10 min at 8050 x g at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...
-
bioRxiv - Bioengineering 2022Quote: ... HA-TBA was dissolved in anhydrous DMSO (2 wt%) with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (BC-1, BCBL-1) or 20% (BC-2, BC-3, BC-5, BJAB) Serum Plus-II (Sigma-Aldrich, catalog number 14009C ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then incubated for 2-3 hours at 4°C with either 5 μl of anti-FLAG-M2 affinity resin (Sigma-Aldrich), Streptactin sepharose (IBA Lifesciences) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1% Triton X-100] and incubated for 2-3 hours at 4°C with either 5 μl of anti-FLAG-M2 affinity resin (Sigma-Aldrich), Streptactin sepharose (IBA Lifesciences) ...
-
bioRxiv - Biochemistry 2020Quote: ... Day 1 adult animals were mounted on 2% (vol/vol) agar pads and immobilized with 30 mg/mL 2-3-butaneione monoxime (BDM, Sigma) in M9 buffer.
-
bioRxiv - Biochemistry 2020Quote: ... animals were mounted on 2% (vol/vol) agar pads and immobilized in 30 mg/mL 2-3-butaneione monoxime (BDM, Sigma) in M9 buffer ...
-
bioRxiv - Immunology 2024Quote: ... the allosteric FFA2R modulator Cmp58 ((S)-2-(4-chlorophenyl)-3,3-dimethyl-N-(5-phenylthiazol-2-yl)butanamide) and adenosine 5′-thriphosphate disodium salt hydrate (ATP) were from Sigma-Aldrich (Merck, Burlington, MA, USA). The FFA2R antagonist CATPB ((S)-3-(2-(3-Chlorophenyl)acetamido)-4-(4-(trifluoromethyl ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hrs followed by addition of 3 µM Asunaprevir (Apexio: BMS-650032) and 500 µM 3-Indoleacetic acid (Sigma Aldrich: I2886). Cells were treated with following inhibitors to inhibit indicated kinases ...
-
bioRxiv - Biochemistry 2024Quote: ... 8029.3), and 0.5% sodium deoxycholate (AppliChem, A1531) in PBS supplemented with Phosphatase Inhibitor Cocktail 2 and Cocktail 3 (Sigma-Aldrich, P5726, P0044) and Complete Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... Colony growth was assessed by crystal violet staining after 2-3 weeks (HA1ER/HA1E: 3 weeks, For this, wells were fixed and stained with 0.1% crystal violet (Sigma-Aldrich, cat. C6158) and 10% ethanol for 30min ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...