Labshake search
Citations for Millipore Sigma :
4301 - 4350 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... in the presence of different concentrations of 3-aminotriazol (3-AT) (Sigma-Aldrich). Quantitative interaction assays were performed in liquid medium by quantifying β-galactosidase activity as previously described (52).
-
bioRxiv - Biophysics 2023Quote: ... and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDC) were purchased from Sigma Aldrich Corp ...
-
bioRxiv - Cancer Biology 2023Quote: Butyrolactone-3 (MB-3) was purchased from Sigma-Aldrich (St Louis, MO, USA) and used at a 100µM concentration ...
-
bioRxiv - Immunology 2024Quote: ... 1mL of 50 mg/mL 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Sigma) in PBS was added ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Bioengineering 2024Quote: ... Amicon Ultra-0.5 (PLBC Ultracel-3 membrane, 3 kDa) and Amicon® Ultra-15 Centrifugal Filters (3 kDa MWCO) were from Millipore (Tokyo, Japan). Calcofluor-white and imidazole were from Sigma-Aldrich (Tokyo ...
-
bioRxiv - Biophysics 2021Quote: ... cells were rinsed three times with PBS containing 0.1 g L−1 Mg2+ and 0.133 g L−1 Ca2+ (PBS++; Sigma-Aldrich) and incubated with glutaraldehyde solution (2.5% (v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 g/l NaCl) supplemented with 1.7 g/l yeast nitrogen base without NH4Cl and amino acids (Sigma Y1251). 1 g/l 15NH4Cl and 4 g/l 13C-glucose were supplemented for 15N and 13C labelling respectively ...
-
bioRxiv - Biochemistry 2020Quote: ... L-aspartic-15N acid (98 atom% 15N) and (D3)-L-methionine (98 atom% D) were obtained from Sigma-Aldrich. Isotopically labeled 13C6-glucose (≥99 atom% 13C ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 g/L NaCl) supplemented with 1.7 g/L yeast nitrogen base without NH4Cl and amino acids (Sigma Y1251). 1 g/L 15NH4Cl and 4 g/L 13C-glucose were supplemented for 15N and 13C labelling ...
-
bioRxiv - Microbiology 2021Quote: ... The pellets were then resuspended in 300µl of cold L-Amino Acid Assay buffer according to the manufacturer instructions (L-Amino Acid Quantification kit, Sigma) and lysates were then centrifuged at 13,000 rpm for 10min at 4°C to remove insoluble material ...
-
bioRxiv - Plant Biology 2020Quote: ... and pre-cultivated on MS1 medium[MS0 with 0.1 g/L IAA (Sangon Biotech Co., Ltd, Shanghai, China) and 1.5 g/L 6-BA (Sigma, USA)] ...
-
bioRxiv - Cell Biology 2021Quote: ... we treated cells for 2 h with 0.5 mM L-leucyl-L-leucine methyl ester (LLOMe; L7393, Sigma-Aldrich).
-
bioRxiv - Genetics 2022Quote: ... Three days later 200 μl of the transfected cells were seeded into new 6-well plates treated with 0.01% poly-L-Lysine (Sigma), followed by selection with 1mg/ml of Zeocin (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.5 g/L NaCl) supplemented with 1.7 g/L yeast nitrogen base without NH4Cl and amino acids (Sigma Y1251). 1 g/L 15NH4Cl and 4 g/L unlabelled glucose were supplemented for 15N labelling ...
-
bioRxiv - Systems Biology 2022Quote: Samples were grown using SD-His+G418 agar and medium selecting for the duplicated chromosomes (6.7 g/L yeast nitrogen base without ammonium sulfate, Difco Cat#233520; 20 g/L glucose, Sigma Cat#Y0626 ...
-
bioRxiv - Systems Biology 2021Quote: Steroidogenic fetal adrenal cells were incubated in cultivation medium in each well with or without 100 nmol/l SST (hor-299-a, ProSprc-Tany) and 0.1mmol/l cholesterol (C3045, Sigma) intervention for 24 h(Damsteegt ...
-
bioRxiv - Cell Biology 2020Quote: ... and osteogenic induction solution (10 mmol/L β-sodium glycerol phosphate, Sigma, USA; 10−8 mol/L dexamethasone, Sigma; 50 μmmol/L ascorbic acid ...
-
bioRxiv - Cancer Biology 2022Quote: ... The thrombin selective inhibitor D-phenylalanyl-L-prolyl-L-arginine chloromethyl ketone dihydrochloride (PPACK.2HCl) was from Millipore Sigma. The stock solutions of the agonists were made in 25 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES ...
-
bioRxiv - Cancer Biology 2022Quote: ... with L-glutamine and 4.5g glucose/L but without sodium pyruvate (Mediatech) supplemented with 10% fetal bovine serum (Sigma) and 1% penicillin/streptomycin.
-
bioRxiv - Immunology 2022Quote: ... 6 mmol/L l-glutamine (BioWhittaker®) and a mixture of penicillin/streptomycin (100U/100 µg/mL, Sigma®) at 37°C in the presence of 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... with drinking water also supplemented with 23.1 g/L of D-fructose and 18.9g/L D-glucose (Sigma-Aldrich) for 7 ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 g/L NaCl) supplemented with 1.7 g/L yeast nitrogen base without NH4Cl and amino acids (Sigma Y1251). 1 g/L 15NH4Cl and 4 g/L glucose were supplemented for 15N labelling ...
-
bioRxiv - Microbiology 2024Quote: ... strains were grown on synthetic complete dropout medium (1.3 g L-1 amino acid powder, 1.7 g L-1 yeast nitrogen base (Sigma, US), 5 g L-1 ammonium sulfate ...
-
bioRxiv - Cell Biology 2023Quote: ... medium with 2.0 g/L amino acid (Sunrise Science)) mix supplemented with 6.7 g/L yeast nitrogen base (Sigma-Aldrich) and 2% w/v glucose ...
-
bioRxiv - Microbiology 2023Quote: ... with 10 mg/L L-cysteine (MP Biomedical cat # 101444) and 10% weight/volume taurocholate (Sigma Aldrich, cat # T4009) and incubated at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... and XP3BR cells were maintained in DMEM containing 4.5 g/L glucose and 2mM l-glutamine (Cytiva) with 10% fetal bovine serum (FBS, Millipore) and 1% penicillin-streptomycin (P/S ...
-
bioRxiv - Microbiology 2023Quote: ... a mix of six sugars (referred to as 6C; 0.45 g/L starch, 0.45 g/L pectin (pectin from citrus peel; Sigma-Aldrich), 0.45 g/L xylan (xylan from oat spelt ...
-
bioRxiv - Genetics 2023Quote: ... EMM-Can-G plates contained 3.75 g/l of glutamate as the nitrogen source and 75 μg/ml of L-canavanine sulphate (Sigma). For inducible nmt1 promoter driven overexpression (42) ...
-
bioRxiv - Molecular Biology 2023Quote: ... U2OS cells were maintained in DMEM containing 4.5 g/L glucose and 2mM l-glutamine (Cytiva) with 10% fetal bovine serum (FBS, Millipore) and 1% penicillin-streptomycin (P/S ...
-
bioRxiv - Immunology 2023Quote: Isolated CD8 T cells were stimulated in culture with 0.5 μg/ml phytohemaglutanin-L (PHA-L, Sigma-Aldrich #L2769) for 18h ...
-
bioRxiv - Microbiology 2023Quote: ... Clean coverslips were coated with poly-L-lysine (PLL) applying a 100 μl droplet of 0.01% poly-L-lysine (P4832, Sigma) for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 100 µg/L in 1× TE buffer with 2 g/L heparin (Sigma-Aldrich, U.K.). Standard solutions from the corresponding RNA stock were also prepared in a 1× TE buffer with 2 g/L heparin to account for any variation in fluorescence ...
-
bioRxiv - Bioengineering 2024Quote: Varying concentrations of the enzyme mixture(0.1-0.3g/L) were added to 1g/L Magnetic Nanoparticles (Iron Oxide Nanoparticles, 15nm, Sigma Aldrich) and incubated at 25°C with shaking at 250 RPM for 2h ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 mM sodium orthovanadate) and 1% N-ocetylglucoside (NOG, Sigma-Aldrich) for 10 min on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies are: Rabbit anti-H3(N-terminal) (Sigma, Catalogue#: H9289, 1:1000), H3K9me3 (Diagenode ...