Labshake search
Citations for Millipore Sigma :
4201 - 4250 of 4323 citations for Recombinant Human SERPINB6 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... reconstructed from a clonotypic plasma blast obtained from the cerebrospinal fluid of a AQP4-IgG-positive NMOSD patient52 together with human complement (15-30 U/ml, Sigma-Aldrich, #S1764) was injected using a custom-made microinjector and a pulled glass capillary (Drummond PCR micropipettes ...
-
bioRxiv - Neuroscience 2024Quote: Human brain pericytes were cultured on a glass coverslip coated with 10 mg/mL of poly-L-lysine (Millipore Sigma, Cat# P8920). Cells were fixed and permeabilized with 4% paraformaldehyde for 15 min ...
-
bioRxiv - Bioengineering 2024Quote: Recombinant active human MMP-9cd (auto-cleavage resistance) 34 with an N-terminal His6x tag was expressed in Rosetta™(DE3) pLysS (Millipore Sigma) cells using a pET-28a(+)-His6x-MMP-9cd vector as previously described 33,35,36 ...
-
bioRxiv - Cell Biology 2020Quote: ... cell lysate was incubated with RIP binding buffer containing magnetic beads coated with human Ago2 antibody or mouse IgG antibody (control) (Millipore, Billerica, MA, USA). Subsequently ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-human α-smooth muscle actin (Cy3 conjugated, cat. #C6198, Sigma Aldrich, 1:500; FITC conjugated, cat. #F3777, Sigma Aldrich, 1:500), rabbit anti-HISTONE H3 (phospho S10 ...
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2019Quote: Sperm from the cauda epididymides of 2-month-old C57Bl/6N male mice were allowed to swim out in Embryomax Human Tubal Fluid medium (HTF, Millipore, MR-070-D) and incubated for capacitation ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently with 5IU of human chorionic gonadotropin (hCG) (Intervet, GesmbH) were mated and zygotes were isolated in M2 media (Merck Millipore, MR-015P-D) and cultured in KSOM medium (Cosmo Bio Co. ...
-
bioRxiv - Bioengineering 2020Quote: GO and RGO substrates were placed in 12-well plates and Fibronectin (FN) from human plasma (Sigma-Aldrich, 10 µg/ml in PBS) solution was added and allowed to adsorb for 1 hour at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... lysates of African green monkey COS-7 cells (Cell Lines Service, Eppelheim, Germany) and human HEK293T cells (ECACC via Sigma-Aldrich, Poznan, Poland) were analyzed by western blotting ...
-
bioRxiv - Neuroscience 2021Quote: Quantification of IL-6 in media was assessed via Human IL-6 ELISA kit according to manufacturer instructions (Sigma Aldrich; St. Louis, MO).
-
bioRxiv - Neuroscience 2021Quote: ... per well of a 6 well plate of differentiated human neural cultures (~2 months old) along with 3μg/ml of polybrene (Sigma-Aldrich #TR-1003-G), pipetting the LV concentrate directly onto the culture (drop-wise) ...
-
bioRxiv - Biophysics 2021Quote: ... myoglobin from equine heart (Myo, CAS number 100684-32-0), human apo-transferrin (apo-TFF, CAS number 11096-37-0) were purchased from Sigma-Aldrich (Merck, Germany) and stored according to manufacturer recommendation ...
-
bioRxiv - Biochemistry 2021Quote: ... These Wild Type or Mutant Type let-7a-5p plasmids were co□transfected into treated human chondrocytes cells along with NC mimics or KCNQ1OT1 mimic (Sigma□Aldrich; Merck KGaA) using Lipofectamine 6000 following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The MILLIPLEX MAP Non-Human Primate Cytokine Magnetic Bead Panel - Premixed 23 Plex – Immunology Multiplex Assay (Millipore, Burlington, MA, USA; #PCYTMG-40K-PX23) was performed on collected plasma samples following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... human bronchoalveloar lavage fluid and mouse serum of animals dosed with human THP were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0751) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: New Zealand rabbits were immunized subcutaneously with 0.4 mg human TNFa (Shanghai Primegene Bi-Tech) in complete adjuvant (Sigma Chemical, St. Louis, MO). After the initial immunization ...
-
bioRxiv - Cell Biology 2019Quote: ... animals were boosted 5 times in a 3 week-interval with 0.2 mg human TNFa in incomplete adjuvant (Sigma Chemical, St. Louis, MO). Final boost was given intravenously with 0.4 mg the protein in PBS four days before splenectomy ...
-
bioRxiv - Immunology 2021Quote: 6 × 106 cells/channel of human umbilical vein endothelial cells (HUVECs, ATCC-PCS-100-013) were seeded into the fibronectin (50 μg/mL, Sigma-Aldrich cat. # F0895) coated channels of a 48-well microfluidic plate (Bioflux ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Molecular Biology 2020Quote: The mouse was induced by injecting 2 month-old female BALB/c mice with2 mg human-derived proteoglycan (PG) together with 2 mg DDA (Sigma, MO, united States). as described previously (1) ...
-
A Universal Proximity CRISPR Cas12a Assay for Ultrasensitive Detection of Nucleic Acids and ProteinsbioRxiv - Synthetic Biology 2019Quote: ... Human serum, magnesium chloride hexahydrate (MgCl2⋅6H2O), and 100×Tris−EDTA (TE, pH 7.4) buffer were purchased from Sigma-Aldrich (Mississauga, ON, Canada). NANOpure H2O (> 18.0 MΩ) ...
-
bioRxiv - Systems Biology 2019Quote: ... The assay named ‘Other Luminex’ was performed only for study SLVP015 in 2007 using the Human 42-Plex Polystyrene Kit (EMD Millipore, H42; MPXHCYTO060KPMX42) and data was processed in the same way as for the Luminex assays described above (measurement units reported were Zlog2)28.
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates from different groups were collected and incubated with magnetic bead RIP buffer containing anti-human argonaute 2 (Ago2) antibody (Millipore, Billerica, MA, USA) and anti-human CPEB2 antibody (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP non-human primate cytokine panel and Luminex 200 (Millipore Corp., Billerica, MA) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human lung fibroblast cells MRC-5 (ATCC® CCL-171) were propagated in Dulbecco’s Modified Eagle Medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... and rested overnight at 37°C/5%CO2 in RPMI-1640 medium supplemented with 10% heat-inactivated human AB serum (Sigma Aldrich, Missouri, USA), 2 mM L-glutamine and 1 mM sodium pyruvate before infection ...
-
bioRxiv - Immunology 2020Quote: ... monoclonal antibodies were produced by transient co-transfection of 293-F cells with human heavy chain and light chain antibody expression plasmids using polyethylenimine (PEI) (Sigma-Aldrich, catalog #408727). Seven days after transfection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Neuroscience 2020Quote: ... untagged human α-synuclein (100 μg/well) —purified as previously described [17]—and 10 μM ThT in dPBS (Sigma-Aldrich, St. Louis, MO) were combined in a final volume of 95 μl of dPBS ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Immunology 2020Quote: Cytokine were measured in cell-free PBMC supernatant using MILLIPLEX-MAP human cytokine/chemokine magnetic bead panel (EMD Millipore Corporation, Billerica, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The pyrosequencing assay was validated using SssI-treated human genomic DNA as a 100% methylation control and human genomic DNA amplified by GenomePlex Complete Whole Genome Amplification kit (Sigma-Aldrich, WGA2-50RXN) as 0% methylation control ...
-
bioRxiv - Immunology 2022Quote: Cells were isolated from human blood using density gradient centrifugation agent Ficoll®-Paque Premium (17-5442-02, GE Healthcare, SIGMA, Darmstadt, Germany). Monocytes were plated at 3×105 cells per well in plastic 24 well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse mAb MEM48 which recognizes the human β2 integrin subunit (catalog #CBL158) and the mouse mAb 1965 against the human β1 integrin subunit (catalog #MAB1965) were from EMD Millipore (Burlington, MA). The rat PE-conjugated mAb against F4/80 (catalog #12-4801-82 ...
-
bioRxiv - Biochemistry 2024Quote: ... Electroporated cells were cultured in erythroid differentiation medium (EDM) consisting of IMDM (GibcoTM, 12440061) supplemented with 330 µg/ml of Holo-Human Transferrin (Sigma-Aldrich, T0665-1G), 10 µg/ml of recombinant human insulin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... Two different Mission lentivirus-based plasmids of shRNAs (clone numbers TRCN0000123050 and TRCN0000436778) against human ZBP1 and the shcontrol vector TRC2 pLKO.5-puro nonmammalian shRNA (SHC202) were obtained from Sigma-Aldrich (Burlington, MA). 293T cells were cotransfected with the shRNA and packaging plasmids psPAX2 and pMD2 using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)36,37 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)32,33 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... human islets were dispersed using dissociation solution (1X TrypLE™ Express solution - Thermo Fisher Scientific, with 40 µg/mL DNase I - Sigma-Aldrich) through gentle pipetting for 10 minutes at 37°C ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... The lentivirus enriched-medium was immediately used to transduce the human fibroblasts growing on a T25 flask in the presence of 8µg/ml polybrene (Sigma-Aldrich, San Luis, MO). Infected fibroblasts were maintained in culture until having enough cells for cell sorting ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: Concentrations of cytokines in supernatants of T cell cultures were assessed with the MILLIPLEX MAP Human Th17 magnetic bead panel kit (Merck Millipore, Burlington, MA, USA) and the Luminex® 200™ system according to the guidelines of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a subsequent 6-day differentiation step in serum-free medium containing 50 ng/ml human brain derived neurotrophic factor (BDNF) (Sigma-Aldrich, Cat# B3795). Cells were seeded at an initial density of 2 × 104 cells/cm2 in 24-well plate coated with Type I collagen (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse (5 x 105 cells) and human (2 x 105 cells) keratinocytes were seeded onto 12 mm diameter inserts (Millipore, Catalog No. PIHP01250) and cultured in CnT-Prime medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cell lysate was generated as a Western blot positive control from the human endometrial epithelium Ishikawa cell line (Sigma-Aldrich, Madrid, Spain), as in a previous study (Vilella et al. ...
-
bioRxiv - Bioengineering 2024Quote: IDUA enzyme expression was measured fluorometrically in a 96-well plate using a Human IDUA ELISA kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s sandwich assay protocol ...