Labshake search
Citations for Millipore Sigma :
4151 - 4200 of 5739 citations for Heme Assay Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... the DuolinkTM In Situ Green Starter Kit Mouse/Rabbit (Sigma-Aldrich, St. Louis, MO, USA) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA purification was performed using a SpinPrep™ PCR Clean-up Kit (Merck Millipore, Germany). DNA fragments were assayed by qRT-PCR using the primer sequences listed below ...
-
Small Molecule Screen Identifies Pyrimethamine as an Inhibitor of NRF2-driven Esophageal HyperplasiabioRxiv - Cancer Biology 2022Quote: The nuclear and cytosolic extracts were prepared using a CelLytic NuCLEA extraction kit (Millipore Sigma) or total protein (whole cell lysate ...
-
bioRxiv - Cancer Biology 2022Quote: ... the metabolic activity was quantified using the Cell counting kit-8 (Sigma-Aldrich, cat# 96992), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cell lines were tested for mycoplasma using the LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) using JumpStart Taq DNA Polymerase (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed with SYBR Green Quantitative RT-qPCR Kit (Sigma-Aldrich; Cat. No. QR0100) using GAPDH as a housekeeping gene ...
-
bioRxiv - Cancer Biology 2023Quote: RIP experiment was optimized using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore, USA) in light of the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA extraction was performed using Extract-N-Amp(tm) Tissue PCR Kits (Sigma/Aldrich). For cDNA synthesis ...
-
bioRxiv - Physiology 2023Quote: ... Antibody binding was detected using an enhanced chemiluminescence HRP substrate detection kit (Millipore; Watford, UK). The following antibodies were used ...
-
bioRxiv - Cell Biology 2023Quote: Alkaline phosphatase test was performed using the Leukocyte Alkaline Phosphatase Kit (86R-1KT, Sigma-Aldrich). First ...
-
bioRxiv - Immunology 2023Quote: Genomic DNA was extracted from PBMCs using the GenElute Blood Genomic DNA Kit (Sigma; NA2010) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA of LG degrading species was extracted using the GenElute DNA extraction kit (Sigma) with inclusion of lysozyme and RNAase.
-
bioRxiv - Microbiology 2022Quote: Gram staining was performed using a Gram Staining Kit (Sigma Aldrich, cat. #77730-1KT-F) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent signal was generated using Duolink In Situ Detection Reagents Red kit (Sigma-Aldrich, DUO92008). Cells were mounted and the nuclei were stained using the Duolink In Situ Mounting Medium with DAPI (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... Glycogen was measured with the same kit using amyloglucosidase (Amyloglucosidase from Aspergillus niger, A1602 Sigma) digestion for 1 hour at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultured cells and parasites were screened against mycoplasma contamination with LookOut Mycoplasma detection kit (Sigma) and Mycoplasma Removal Agent (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μm sections were cut and stained using a Periodic acid-Schiff staining kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... X26 and X33 using GenElute bacterial genomic DNA extraction kit (Sigma-Aldrich, St. Louis, MO), and sequenced on a Nanopore platform (PromethION48 ...
-
bioRxiv - Immunology 2024Quote: ... MMP-9 (RAB0372-1KT) and BMP2 (RAB0028-1KT) ELISA kits were obtained from Millipore Sigma, and sRANKL (MBS262624 ...
-
bioRxiv - Cell Biology 2024Quote: SA-β-Gal staining was performed using the Senescence Cells Histochemical Staining Kit (Sigma, CS0030) as described previously61 ...
-
bioRxiv - Cancer Biology 2024Quote: The PLA was performed using the Duolink In-Situ Red Starter Kit (Millipore Sigma, DUO92101) following manufacturers instructions with an extended amplification period of 3H instead of the recommended 1H ...
-
bioRxiv - Neuroscience 2024Quote: ... All other steps were performed according to kit instructions (Millipore Sigma, cat# HCYTA-60K-PX48). For graphing and statistical purposes ...
-
bioRxiv - Cell Biology 2024Quote: RNA purification of sorted fractions was performed using the GeneElute Total RNA kit (Sigma-Aldrich) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Cell lines were tested for mycoplasma using the LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich) using JumpStart Taq DNA Polymerase (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... Cytokine and chemokine levels were assessed using the Milliplex Mouse 32-plex premix kit (Millipore) as per manufacturers’ instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DNA amplicons were purified using the GenElute PCR clean-up kit (Sigma-aldrich, MO, USA) and sent for single direction sanger sequencing at AGRF at Westmead ...
-
bioRxiv - Neuroscience 2024Quote: ... Fluorescence detection of nitrated NDUFB8 was achieved using a Duolink Red Detection Kit (Sigma-Aldrich); sections were then stained with anti-hASYN (MJFR1 ...
-
bioRxiv - Neuroscience 2024Quote: ... aggregated and nitrated hASYN signals were detected using a brightfield detection kit (Duolink, Sigma-Aldrich). Fluorescence detection of nitrated NDUFB8 was achieved using a Duolink Red Detection Kit (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... MAFF and control siRNA using the GenEluteTM Single Cell RNA Purification Kit (#RNB300, Sigma-Aldrich), following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Fatty acid uptake was measured by using the Fatty Acid Uptake kit from Sigma-Aldrich. Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Elastic fibers were stained with a modified Verhoeff Van Gieson elastin stain kit (Sigma-Aldrich). Elastic lamina breaks ...
-
bioRxiv - Microbiology 2024Quote: ... All strains were verified to be Mycoplasma-negative using LookOut mycoplasma PCR detection kit (Sigma). For chlamydial transformations ...
-
bioRxiv - Plant Biology 2024Quote: ... The plasmid DNA used was prepared using GenElute™ HP plasmid maxiprep kit (Sigma-Aldrich). The protoplasting solution contained 5 mg/mL Extralyse (Laffort ...
-
bioRxiv - Neuroscience 2024Quote: ... PLA was performed using the Duolink In Situ Detection Reagents Orange kit (DUO92007, Sigma-Aldrich). Fixed HUVECs ...
-
bioRxiv - Cell Biology 2024Quote: The H2AX phosphorylation (γH2AX) for fluorescence-activated cell sorting (FACS) kit (Sigma-Aldrich, 17-344) was used to prepare cell samples following the manufacturer’s protocol for fixation ...
-
bioRxiv - Molecular Biology 2024Quote: ... purified using the High Pure PCR product purification kit (11732676001; Sigma- Aldrich, Saint Louis, MO), and sequenced using Illumina NovaSeq 6000 system (paired-end sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: PLA was performed using a Duolink In Situ Detection Kit (Sigma-Aldrich, DUO92001, DUO92005, DUO92008) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... a second PCR was performed using the Phusion RT-PCR Enzyme Mix kit (Sigma-Aldrich) and primers Bat1F 5’- GGTTGGGACTATCCTAAGTGTGA -3’ and Bat1R 5’-CCATCATCAGATAGAATCATCAT-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... alkaline phosphatase (AP) activity was measured using an AP staining kit (Sigma-Aldrich, 86R-1KT). ESCs were plated at 1 x 103/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using SYBR® Green Quantitative RT-qPCR kit (Sigma Aldrich) and splice site-specific primers (Supplementary Table 8) ...
-
bioRxiv - Cell Biology 2024Quote: ... Detection of the hybridized antibody was performed using and ECL detection kit (Immobilon Western, Millipore), and the signal was visualized with a digital camera (VersaDoc ...
-
bioRxiv - Biochemistry 2024Quote: ... Gel filtration calibration kits (GE #28-4038-41, GE #28-4038-42, Sigma #MWGF200-1KT) were used to monitor column performance over time ...
-
bioRxiv - Cell Biology 2024Quote: Gene expression was measured using the KAPA SYBR One-Step qRT-PCR kit (Sigma, SF1UKB) using the manufacturer’s protocol and the following PCR primers:
-
bioRxiv - Cancer Biology 2024Quote: ... M0 or control conditioned medium and cell number was determined (MTT kit, Sigma-Aldrich, 11465007001).
-
bioRxiv - Cancer Biology 2024Quote: ... Levels of plasma antibody were measured with the Human IgG Total ELISA Kit (Sigma Aldrich) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... mice tip tail genomic DNA preparations were extracted using REDExract-NAmp tissue PCR kit (Sigma), followed by amplification reactions performed with oligonucleotide pairs (see Table 2 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... From these cultures we extracted genomic DNA using GenEluteTM Bacterial Genomic DNA Kit (Sigma, NA2110). The concentration of genomic DNA varied between 83.77 to 205 ...
-
bioRxiv - Plant Biology 2020Quote: ... ground to a fine powder and RNA was extracted (Spectrum™ Plant Total RNA Kit, Sigma). Biological replicates were pooled ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from frozen apical leaves using a Plant Spectrum Total RNA Kit (Sigma), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from Nb-1 shoots with the Spectrum Plant Total RNA kit (Sigma-Aldrich) with on-column DNase I digestion (New England Biolabs) ...