Labshake search
Citations for Millipore Sigma :
4001 - 4050 of 10000+ citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The lysate was transferred to a pre-chilled 7 ml dounce homogenizer (Sigma-Aldrich D9063) and dounced using loose and tight pestles for 40 times each ...
-
bioRxiv - Immunology 2020Quote: ... 7-μm bone sections were stained for TRAcP activity (leukocyte acid phosphatase kit, Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... MK-801 and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) all purchased from Sigma-Aldrich, also with AR-C155858 and (S)-3,5-Dihydroxyphenylglycine hydrate (DHPG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Briefly BECs were transfected with siRNAs and stimulated with 10−7 M dexamethasone (Sigma Aldrich). 500 μg/ml cyclohexamide (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in xylene for a minimum of 7 minutes and coverslipped with DPX (Sigma Aldrich).
-
bioRxiv - Biochemistry 2023Quote: ... 4,4’-(propano-2,2-diil)difenol (BPA) CAS number: 80-05-7 (Sigma-Aldrich, Madrid, Spain), d16-BPA CAS number ...
-
bioRxiv - Bioengineering 2024Quote: ... day 7 neurospheres were cultured in DFNBEb medium supplemented with: 0.5 µM ATRA (Sigma-Aldrich), 3 µm CHIR99021 (Stemgent ...
-
bioRxiv - Genomics 2023Quote: ... The lysate was transferred to a pre-chilled 7 mL Dounce homogenizer (Sigma-Aldrich D9063) and Dounced using loose and tight pestles for 40 times each ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:1000 anti-HA mouse monoclonal antibody (Clone HA-7, mouse IgG1 Isotype; Sigma-Aldrich), or 1:1000 anti-ACP antibodies (a kind gift from Prof ...
-
bioRxiv - Neuroscience 2022Quote: ... 7-8dpf zebrafish larvae were anesthetized by briefly immersing them in 0.017% MS222 (Sigma-Aldrich) and embedded dorsal side up in a drop of 2% low gelling temperature agarose (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with two 24 h doses of β-ecdysone (Sigma 5289-74-7) at 1 ug/ml separated by 24 h in non-supplemented medium.
-
bioRxiv - Microbiology 2023Quote: ... Cells were then resuspended in BD Perm/Wash Buffer with 7% NGS (Sigma Aldrich G9023) and incubated for 1 hour at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... was dissolved at 20mg/mL in corn oil (Sigma-Aldrich #C8267, CAS #8001-30-7) overnight by agitation at 37℃ in the dark ...
-
bioRxiv - Biochemistry 2023Quote: ... concentrated protein (7-15 mg/ml) was serially diluted in 1% Genapol X-100 (Sigma). 0.3-0.5 μl of diluted protein was added to the cis (ground side ...
-
bioRxiv - Biophysics 2023Quote: ... The anti-human Fc capturing mAb (GG-7) was from Sigma-Aldrich (St. Louis, MO). LIBS-2 was purchased from EMD Millipore (Billerica ...
-
bioRxiv - Cell Biology 2023Quote: ... and for 7 days with 400 μg/ml G418 disulfate salt (A1720-5G, Sigma-Aldrich). To induce transgene expression ...
-
bioRxiv - Cell Biology 2024Quote: ... the mixture was dounced in a glass douncer in ice (7 ml, Kimble D9063, Sigma) with 50 strokes using the type A pestle followed by 3 strokes with type B pestle ...
-
bioRxiv - Neuroscience 2020Quote: Mice were anesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p) and placed into a stereotactic frame (Kopf) ...
-
bioRxiv - Neuroscience 2021Quote: Mice were anaesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p.) and were surgically implanted with a microdrive (manufactured with the assistance of the Advanced Manufacturing Support Team ...
-
bioRxiv - Neuroscience 2020Quote: Mice were anaesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p.) and were surgically implanted with a microdrive (manufactured with the assistance of the Advanced Manufacturing Support Team ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2% glucose) or YPL (0.5% yeast extract, 2% peptone and 2% lactate (Sigma L1375)) ...
-
bioRxiv - Bioengineering 2023Quote: Photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy) phenyl]-2-methyl-1-propanone (HEPK, Sigma Aldrich) was dissolved into deionized water to obtain an approximately 0.077 wt% solution ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mice were maintained on antibiotic water for two weeks (Polymyxin B sulfate salt, Sigma-Aldrich P1004 ...
-
bioRxiv - Microbiology 2020Quote: ... subtype VI-B: 289 bp) were extracted from the phage-treatments using X-tracta (Sigma) extraction tools and Gel Extraction Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Thawed sperm was preincubated for 30 minutes in TYH (with Methyl-b-cyclodextrin, Sigma C4555) medium at 37 deg C ...
-
bioRxiv - Cell Biology 2022Quote: ... and amphotericin B (25 µg/ml) at pH 7.87 (all Sigma Aldrich, St Louis, MO)] and then incubated at 35°C ...
-
bioRxiv - Genomics 2020Quote: ... CD19+ B-lymphocytes and CD14+ monocytes were isolated by negative selection using RosetteSep kits (Sigma). Macrophages were produced from monocytes by culturing in RPMI with 20% fetal calf serum with 50 ng/ml M-CSF for one week as described [53] ...
-
bioRxiv - Biochemistry 2019Quote: ... lysed with a sodium phosphate lysis buffer solution (pH 8) containing CelLytic B (Sigma Aldrich), lysozyme ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclear export inhibition was carried out using media containing 20 nM leptomycin-B (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2019Quote: ... and maintained in DMEM supplemented with 10 μg/ml of Cytochalasin B (Sigma-Aldrich, USA) for 30 min (37°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cells were treated with 4.5 μg/mL Cytochalasin B (Sigma-Aldrich, St. Louis, MO, USA) for 24 hours to block cytokinesis ...