Labshake search
Citations for Millipore Sigma :
4001 - 4050 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Huh7 cells (5 x 104 cells) were treated with 5 μg/ml of actinomycin D in DMSO (Sigma-Aldrich). Samples were harvested at the indicated times for total RNA extraction using the NucleoSpin RNA kit (Macherey Nagel ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed and resuspended in lysis buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.1% NP-40, 1 mM PMSF, 1× yeast protease inhibitor cocktail [Sigma]). Cells were lysed by using a bead beater (Biospec products ...
-
bioRxiv - Microbiology 2024Quote: ... crude extracts were obtained from systemic leaves of the BBWV2-53/37-Flag-infected plants by homogenizing the leaves in three volumes of protein extraction buffer (20 mM Tris–HCl at pH 7.5, 300 mM NaCl, 5 mM MgCl2, 5 mM dithiothreitol, 0.5% Triton X-100, proteinase inhibitor cocktail [Sigma, USA]). Cell debris was removed via centrifugation at 18,000 g for 20 min at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... brains were homogenized in ice-cold HEPES-buffered sucrose (0.32 M sucrose, 4 mM HEPES pH 7.4, 5 mM EDTA, 5 mM EGTA, protease inhibitor cocktail, from Sigma) using a motor driven glass-teflon homogenizer ...
-
Co-release of GABA and ACh from medial olivocochlear neurons fine tunes cochlear efferent inhibitionbioRxiv - Physiology 2024Quote: ... in the case of ChAT;tdTomato mice or 5% normal donkey serum + 5% normal goat serum (S26-100ML, Millipore) for GAD;tdTomato mice ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times for 5 min in PBS before permeabilization for 5 min with 0.5 % NP-40 (Sigma) in PBS ...
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 2 dpf in egg water with 0.003% 1-Phenyl-2-thiourea (PTU; Sigma, Cat#P7629) to suppress pigmentation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were dissected and embedded in 2% low melting agar (2-hydroxymethyl agarose, Sigma Aldrich), mounted on a vibratome (DSK Microslicer ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were incubated for 2 hours at room temperature with 2% normal donkey serum (Sigma, G6767) in PBS overnight at 4 °C with c-Fos primary antibodies (226003 ...
-
bioRxiv - Microbiology 2024Quote: ... 2-hydroxyibuprofen (2-OH-IBU) and carboxyibuprofen (CBX-IBU) were obtained from Sigma-Aldrich (Steinheim, Germany). All chemicals and solvents used were of the highest purity available.
-
bioRxiv - Biochemistry 2023Quote: 2-Pyridinecarboxaldehyde (1) and 6-(1-piperazinylmethyl)-2-pyridinecarboxaldehyde bistosylate salt were purchased from Sigma-Aldrich. 5-Ethynylpicolinaldehyde (“alkyne-2PCA” ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was applied on an already equilibrated 2-(2-pyridyl)ethyl columns (Sigma 54127-U) with 1 ml of 50% MeOH with 2% acetic acid ...
-
bioRxiv - Plant Biology 2023Quote: ... 2% ß-mercaptoethanol and 2 tablets/10ml of complete EDTA free protease inhibitor (Sigma Aldrich, USA), 100μM E-64 cysteine protease inhibitor (Bera et al. ...
-
bioRxiv - Neuroscience 2024Quote: Under Avertin anesthesia (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) male A2A-Cre and D1-Cre mice (≥ 8 weeks old) ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Immunology 2024Quote: ... and 2 μg/ml of L-tosylamido-2-phenyl ethyl chloromethyl ketone (TPCK) (Sigma-Aldrich, MO). The virus containing supernatant was harvested after 72 hours and the viral titer was determined by standard plaque assay ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 mmol/L MgSO4 (Millipore Sigma), 0.1 mmol/L CaCl2 (Millipore Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM glutamine (G8540, Sigma-Aldrich), 100 units/ml penicillin G (P3032 ...
-
bioRxiv - Biophysics 2021Quote: ... and Mg(NO3)2 (Sigma-Aldrich) in 50 mM HEPES (pH 7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of Flag (Sigma #F1804) antibody were added to each CTRL/TRIM67 IP samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2-Deoxyglucose (Sigma-Aldrich; 50 mM) was used to return ECAR to baseline ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM L-glutamine (Sigma-Aldrich), 5 mM pyruvate (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... sodium pyruvate and 2-mercaptoethanol (Sigma)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM Alanyl-glutamine (Sigma G8541), 1 mM sodium pyruvate (Merck TMS-005-C) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 mM glutamine (both from Sigma) and 10 mM glucose (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml heparin (Sigma)] for 5 days ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µg/ml puromycin (Sigma-Aldrich) was added to select transduced cells.
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mM L-glutamine (Sigma) at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μM 2-ME (Sigma-Aldrich), and 1% Penicillin/Streptomycin (Thermo Fisher).
-
bioRxiv - Cell Biology 2020Quote: ... or 2% D-glucose (D; Sigma) or in Synthetic Complete (SC ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 % BSA (Sigma-Aldrich, # A7906) using a 1 ml pipet tip with the tip cut off to allow aspiration of larger pieces ...
-
bioRxiv - Cell Biology 2020Quote: ... Ndiff Neuro-2 medium supplement (Millipore), B-27 medium supplement (Gibco) ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: ... 2 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Cell Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma) was used to eliminate dead cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM hydroxyurea (HU) (Sigma-Aldrich) was added directly to the cell culture medium for 23 h ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.09 M of 2-mercaptoethanol (Sigma) and 10% FBS (Atlanta Biologicals) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 U/ml erythropoietin (EPO, Millipore) and plated in a standard 12-well plate (2 mL/well) ...
-
bioRxiv - Genetics 2021Quote: ... 2 IU ml-heparin (Sigma, H3149), 5% human solvent detergent pooled plasma AB (Rhode Lisland Blood Center) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM L-Glutamine (Sigma, G7513), 1,000 U/ml leukemia inhibitory factor (LIF ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 mM 2-Mercaptoethanol (Sigma-Aldrich). Cells were counted to determine the cell concentration ...