Labshake search
Citations for Millipore Sigma :
3951 - 4000 of 10000+ citations for Urotensin 2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and 50 μM 2- Mercaptoethanol (Sigma). Keratinocytes were isolated from 1-2 days old iTAP KO and WT neo-natal epidermis following the protocol of CELLmTEC ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% SDC (Sigma-Aldrich Cat#SER0046), 1% SDS (Roth Cat#4360.2) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Heparin (Sigma)] ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Heparin (Sigma)] ...
-
bioRxiv - Cell Biology 2022Quote: ... a 2% gelatin-coated (Sigma-Aldrich) 6-0 nylon monofilament sterile suture (eSutures ...
-
bioRxiv - Microbiology 2022Quote: ... and 2 μM Pyrimethamine (Sigma Aldrich) as described for non-integrating plasmids and P52 integrating plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 mM 2-mercaptoethanol (Sigma, M3148). Maintenance medium was freshly supplemented with 0.44 nM mLif (Amsbio ...
-
bioRxiv - Microbiology 2022Quote: ... glutamine (2 mM; Sigma-Aldrich, USA), penicillin (50 units/ml ...
-
bioRxiv - Immunology 2022Quote: ... 50 μM 2-ME (Sigma-Aldrich), 100 μM MEM Non-Essential Amino Acids solution (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... and 2-5 mM ATP (Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... and DNaseI (2 units/mL, Sigma). Papain solution was activated 10 mins prior to enzymatic digestion with L- cysteine (1 mM ...
-
bioRxiv - Physiology 2022Quote: ... or anti-neurophysin 2 (MABN856 – Sigma) (41 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Deoxyribonuclease I (2 mg/ml, Sigma) and magnesium chloride (1 M ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μg/ml Doxycycline (Sigma, #D3072) was added to the medium from day 5-13 ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mM 2-mercaptoethanol (Sigma, M3148) and leukemia inhibitory factor (LIF) ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 5% 2-mercaptoethanol (Sigma-Aldrich) and loaded directly onto 4-20% Tris-Glycine mini gels (Thermo Fisher XP04205BOX ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 2.5% 2-mercaptoethanol (Sigma-Aldrich). These samples were loaded onto 4–12% Bis–Tris Mini gels (Thermo Fisher NP0335BOX ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 mM L-glutamine (Sigma-Aldrich), 1x Penicillin-Streptomycin (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5M 2-AMP (A9199, Sigma Aldrich), 2mM MgCl2 (25108.260 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 mM L-Glutamine (G7513, Sigma), 1% v/v penicillin/streptomycin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Slides were mounted with Elvanol mounting medium.
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (Sigma-Aldrich), 100 units/ml penicillin ...
-
bioRxiv - Molecular Biology 2024Quote: ... and ZM323881 (Sigma-Aldrich; 2 µM) for the duration of the assay.
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg/mL dexamethasone (Sigma D4902), 850 nM insulin (Sigma ...
-
bioRxiv - Genetics 2024Quote: ... fixed in 2% formaldehyde (Sigma #F8775) for 30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% donkey serum (Sigma-Aldrich). Primary antibodies [cTnT (ab45932) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 uM A83-01 (Sigma). Half medium changes were then performed on days two and four with the exclusion of ROCK inhibitor ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μM forskolin (F6886, Sigma-Aldrich), and 4% KSR ...
-
bioRxiv - Molecular Biology 2023Quote: ... β-estradiol (Sigma, 50-28-2) was then added to a final concentration of 2 nM for 2 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and thymidine (2 mM, Sigma-Aldrich).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... fresh 2-mercaptoethanol (99%, Sigma– Aldrich), and 0.1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 Na2-ATP (Sigma-Aldrich, #A7699), 0.3 Na-GTP (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... oligomycin (2 μg/ml, Sigma-Aldrich), an inhibitor of ATP synthesis ...
-
bioRxiv - Microbiology 2024Quote: ... 2 g/L glucose (Sigma G7021), and 10 mg/L gentamicin (Invitrogen 15750060) ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 μL of 2% formalin (Sigma) were injected subcutaneously into the dorsal surface of the hindpaw ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM L-glutamine (Sigma, G7513). For selection of the Tet repressor and the Flp-In recombination target (FRT ...
-
bioRxiv - Molecular Biology 2024Quote: ... phosphatase inhibitor cocktail #2 (Sigma #P5726), and #3 (Sigma #P0044 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 mg/mL doxycycline (Sigma) to initiate NGN2 overexpression ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/mL puromycin (Sigma). Medium was exchanged daily with fresh medium for three additional days ...
-
bioRxiv - Neuroscience 2024Quote: ... and rotenone (2 μM, Sigma-Aldrich), an inhibitor of mitochondrial complex I ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2% glucose (D; Sigma) or in csm (complete supplement mixture ...
-
bioRxiv - Microbiology 2024Quote: ... with 2% Yeast Extract (Sigma, Y1625) at 37°C with 5% CO2 until they reached an OD600 of 0.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... RU486 2 µM (Sigma, cat# M8046), CHX 1 µg/ml (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 0.05 µM 2-mercaptoethanol (Sigma-Aldrich) and 100 U/ml human IL-2 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Neuroscience 2024Quote: ... and shCdk5rap2-2 (GCCATCAAGATACGATTCATT) (Sigma, TRCN0000183538).
-
bioRxiv - Microbiology 2023Quote: ... 2 mM L-glutamine (Sigma Aldrich), 15 mM HEPES (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM L-glutamine (Sigma Aldrich), and non-essential amino acids (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg/ml of DAPI (MilliPore) was added to stain nuclei ...
-
bioRxiv - Immunology 2024Quote: ... 2 mg mL−1 collagenase (Sigma), DNase 12.5 U mL−1 (Roche ...