Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for Recombinant Human Programmed Cell Death 1 Ligand 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-His antibody (1:12000) (Sigma-Aldrich) and biotinylated PNA (1:6000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and Anti-His(1:3000) antibody(Sigma #H1029).HRP conjugated mouse IgG was used at 1:4000 dilution(Sigma #A3673 ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-His (Sigma H1029; 1:3000 for IB), anti-Hsp70 (Abcam ab47455 ...
-
bioRxiv - Biochemistry 2024Quote: ... An anti-His-primary antibody (Sigma, 1:2,000) was incubated with the protein-treated lipid strips to detect Jps1 bound via its C-terminal His-tag ...
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cell Biology 2023Quote: Lentivirus containing a plasmid programmed to express either CMIP-specific sgRNA (ACGTCTTCAATGGCGCTGTAGG, Millipore Sigma, Sanger Clone MM5000005403) or non-targeting control sgRNA (Millipore Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... respectively (Millipore Cat# HI-14K, HI-13K). Samples treated with 3 mM glucose KRBH were measured undiluted ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Genomics 2020Quote: ... RPMI-1640 medium used to culture the MCF7 cells was additionally supplemented with 0.01 mg/ml human recombinant insulin (Sigma Aldrich, #I3536).
-
bioRxiv - Cancer Biology 2021Quote: ... PAI-2 human Plasminogen Activator Inhibitor-2 (SRP3137; Sigma Aldrich); Placenta Growth Factor human (P1588 ...
-
bioRxiv - Immunology 2023Quote: ... The pull-downed proteins were separated by SDS-PAGE on 10-to-20% gradient gel (ATTO) and the recombinant FLAG- tagged WT sCTLA-4 was detected by anti-FLAG M2 antibody (Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2021Quote: TUNEL analysis was performed using the In Situ Cell Death Detection Kit (Kit #11684795910, Sigma Aldrich) following manufacturer’s recommendations and fluorescein-dUTP ...
-
bioRxiv - Cell Biology 2021Quote: Apoptosis in kidneys was detected using the In Situ Cell Death Detection Kit (Sigma Aldrich/Roche). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Brains were then incubated with TUNEL reagent (In Situ Cell Death Detection Kit, TMR red, Sigma) for 14-16 hours at 37°C in dark humid chamber ...
-
bioRxiv - Immunology 2023Quote: ... TUNEL staining was conducted following antigen retrieval using the In Situ Cell Death Detection Kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and TUNEL staining was performed using the Fluorescein in situ Cell Death Detection Kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... and then incubated in the TUNEL reaction mixture (In Situ Cell Death Detection Kit; Sigma, 11684795910) for 1 hr at 37°C in the dark ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 ng/mL of recombinant human IL-13 (Sigma-Aldrich, St. Louis, MO) to promote differentiation into M2 macrophages ...
-
bioRxiv - Cell Biology 2019Quote: Morphogenesis was induced by the addition of recombinant human HGF (product H1404, Sigma-Aldrich) and conditioned media from NIH/3T3 cells (product CRL-1658 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... human recombinant MAO-A (hMAO-A) and MAO-B (hMAO-B) enzymes (Sigma-Aldrich) were diluted in 50 mM phosphate buffer (final protein amount ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... ephyrae were placed in ASW supplemented with 500 nM human recombinant insulin (Sigma I0908). Insulin was refreshed weekly ...
-
bioRxiv - Cell Biology 2021Quote: Human recombinant TNFα and LPS (from Escherichia coli O111:B4) were purchased from Sigma. VCAM-1 (sc-13160) ...
-
bioRxiv - Cell Biology 2021Quote: A549 cells expressing GFP-tagged EGFR were obtained from Sigma. Cells were plated on Edge plates (Thermo Scientific ...
-
bioRxiv - Genetics 2019Quote: FLAG-tagged proteins were immunoprecipitated from 2 mg of HEK293T or M17 cells using anti-FLAG M2 affinity gel (Sigma A2220). Lysates were prepared in NP40 buffer (see Western blotting) ...
-
bioRxiv - Biochemistry 2023Quote: Hexahistidine tagged hMDC1 BRCT (residues: 1891 – 2089) was cloned into pET47b vector and expressed in Rosetta™ 2(DE3) cell lines (Novagen). Cells in 1L Luria Broth (LB ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to the cell pellet and stored at −20°C prior to being assayed for insulin using human insulin specific RIA (Millipore Cat# HI-14K).
-
bioRxiv - Cell Biology 2022Quote: Flag-tagged proteins were captured from 1 mg total cell lysate using anti-Flag affinity matrix (Sigma) for 1 hour at 4°C ...
-
bioRxiv - Biophysics 2023Quote: ... GST-tagged Elf1 protein was expressed in Escherichia coli strain Rosetta 2(DE3) (Novagen) and purified by Glutathione Sepharose 4 Fast Flow resin (GE Healthcare) ...
-
bioRxiv - Neuroscience 2020Quote: Human THP-1 cell lines were purchased from Sigma Aldrich and cultured in RPMI 1640 (Life technologies) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and THP-1 human monoblast cells (EMD Millipore, Billerica, MA) were used to construct the liver model for testing 14 compounds ...
-
bioRxiv - Biochemistry 2022Quote: ... PTP-tagged or MHTAP-tagged protein variants were detected using the peroxidase-anti-peroxidase soluble complex (PAP) (1:2000, Sigma) as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were lysed and processed for cell death detection ELISA assay by following the manufacturer’s instruction (#11774425001, Millipore Sigma). At the end of the assay ...
-
bioRxiv - Bioengineering 2021Quote: ... The liquid handling platform was programmed to pipette the samples onto a 0.2 μm filter plate (Millipore MSGVN2210) for filtration ...
-
bioRxiv - Bioengineering 2021Quote: ... and 50 ng mL−1 receptor activator of nuclear factor kappa-B ligand (Sigma Aldrich). The scaffold was then perfused at 56 μL per second for 28 days in the same medium ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp., St. Louis, MO, USA), or control phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... THPTA ligand (100 μM, Cat# 762342, Millipore Sigma) and mixed on a rotor at room temperature for 2 h ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5 mM of ligands (purchased from Sigma) such as ornithine ...
-
bioRxiv - Microbiology 2019Quote: ... Removal of His-tag was verified by western blot with monoclonal α-His –HRP (1:10000) antibody (Sigma).
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-His-HRP (A7058, Sigma-Aldrich, 1:10000).
-
bioRxiv - Biochemistry 2023Quote: ... His tag and Flag tag (1:1000; F3165, Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Human interleukin-2 (IL-2) (H7041) was purchased from Sigma Aldrich. Ficoll-PaqueTM PLUS (17-1440-02 ...
-
bioRxiv - Biochemistry 2021Quote: ... His-tagged CLIP-170 fragments and mutants were expressed in BL21 (DE3) and purified by the standard His-tagged purification protocol from Novagen (69670-5, Sigma-Aldrich) with the following modifications ...
-
bioRxiv - Biochemistry 2023Quote: Thermal stability of BSA and HSA variants (His-tagged form) and of commercial wild type HSA and BSA (Sigma-Aldrich A1653 and A7638, respectively) was measured by nanoscale differential scanning fluorimetry (nanoDSF) ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Using the commercial Click-iT TUNEL (In Situ Cell Death Detection Kit, Fluorescein – Sigma-Aldrich – ref 11684795910) colorimetric detection kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... TUNEL staining was performed using a commercial kit (In Situ Cell Death Detection Kit, TMR (Sigma, 12156792910)) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell death was assessed by Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL; S7100, Merck Millipore). Images were obtained with a Leica DM3000 microscope with a mounted Leica DFC420 camera ...
-
bioRxiv - Developmental Biology 2020Quote: ... individual components can be added to 500 ml media bottle at the indicated final concentrations: 1) Recombinant Human Insulin (Sigma I-1882) – 12.5 µg/ml final concentration ...