Labshake search
Citations for Millipore Sigma :
351 - 400 of 7631 citations for Dengue Virus Serotype 3 VLP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Virus was collected 24- and 48-hours post-transfection and filtered through a 0.45μm filter (EMD Millipore) and used for transduction of MCF-10A cells in the presence of polybrene (8μg/mL) ...
-
bioRxiv - Neuroscience 2021Quote: Each animal (with DREADD virus injection) received CLZ (0.5 mg/kg, Sigma-Aldrich, dissolved with 0.1% DMSO) or vehicle (sterilized saline with 0.1% DMSO ...
-
bioRxiv - Immunology 2022Quote: ... the antibody-virus mixture was removed and 100 μl of prewarmed 0.85% methylcellulose (Sigma-Aldrich, #M0512-250G) overlay was added to each well ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLVX-EF1α-mKate2-WPRE-Neo virus supplemented with 10 µg/ml polybrene infection/transfection reagent (Sigma-Aldrich) was incubated with PSCs grown in monolayer for 24 h ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... virus was also concentrated using Amicon Ultra-15 Centrifugal Filter Units with 100 kDa cutoff (Merck Millipore). Mice were injected s.c ...
-
bioRxiv - Microbiology 2021Quote: ... and 10% formamide in DEPC-treated H2O) with anti-influenza A virus NP antibody (Millipore, 1:2,000) and FISH probes ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were transduced with 4 µL library virus/well along with 8 µg/mL Polybrene (Sigma-Aldrich) aiming for an MOI at 0.3-0.4 (Supplementary Methods and Results) ...
-
bioRxiv - Immunology 2022Quote: ... Cells were then cultivated with the virus in the presence of 4 μg/ml polybrene (Sigma-Aldrich) for 12 hr.
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with virus (MOI 0.5-1.0) and 5 µg/mL Polybrene (EMD Millipore, TR-1003). Polyclonal cells were selected for 2 weeks in 250 µg/mL G418 (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2020Quote: Virus carrying the gene of interest was used to infect cell lines with 10mg/mL polybrene (Millipore). Media was replaced after 24 h and cells were sorted for GFP positivity after 48-72 h post-infection ...
-
bioRxiv - Genetics 2019Quote: ... The resulting myoblasts were then infected with a retroviral cocktail containing Myf6-CTAP virus and polybrene (Millipore) for 8 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Suspensions of L-cells (from ATCC) for virus production were maintained in Joklik MEM medium (Sigma-Aldrich) supplemented with 1% L-Glutamine (Gibco.) ...
-
bioRxiv - Cell Biology 2020Quote: ... Supernatant containing the virus was collected after 72 hours and filtered through a 0.22 micron PES (Millipore) filter ...
-
bioRxiv - Genomics 2021Quote: ... Harvested media containing the desired virus were filtered through Millex-HV 0.45-µm PVDF filters (Millipore, SLHV033RS) and further concentrated with 100,000 NMWL Amicon Ultra-15 centrifugal filter units (Amicon ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant containing propagated virus was filtered through an Amicon Ultra 15 (100 kDa) centrifugal filter (Millipore Sigma) at ~4000 rpm for 20 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... virus was purified using centrifugal filter devices (Centricon Plus-70 and Biomax 100.000, Millipore Corp., Bedford, MA) and stocks with a titre between 3×109 and 3×1010 viral genome equivalents (vge ...
-
bioRxiv - Immunology 2021Quote: ... the antibody-virus mixture was removed and 100 µl of prewarmed 0.85% methylcellulose (Sigma-Aldrich, #M0512-250G) overlay was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa or U2OS cells were transduced with virus for 48 h with 10 μg/ml polybrene (Sigma), then optimized for protein expression via fluorescence sorting or puromycin selection.
-
bioRxiv - Immunology 2022Quote: ... Virus was absorbed for 1 hour at 37 degrees C before 1% (w/v) methylcellulose (Sigma-Aldrich) (10 g methylcellulose in 1L MEM (Corning) ...
-
bioRxiv - Microbiology 2022Quote: ... virus was preincubated for 1 hr at 4 °C with 100 μg/mL soluble H (Sigma H4784), HS (Sigma H7640) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Virus containing media were harvested 48-64 h later and filtered by 0.45 μm Steriflip filter (Millipore). HepG2 and Huh7 cells were infected with 1 ml virus containing medium with 8 μg/ml polybrene for 24 h ...
-
bioRxiv - Microbiology 2022Quote: ... Each SARS-CoV-2 virus was isolated after three passages in Vero cells in DMEM (Sigma Aldrich). Virus isolation was confirmed by RT-PCR using E gene-specific primer sets (Extended Data Table 2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the medium was replaced with virus-containing medium supplemented with 8 µg/mL of polybrene (Sigma-Aldrich). Approximately 24 hours post-viral treatment ...
-
bioRxiv - Microbiology 2023Quote: ... Filtered virus-containing medium was mixed 1:1 with fresh HaCaT media and 1:1000 polybrene (Sigma), and used to transduce HaCaT cells overnight [75] ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing virus particles was collected after 48h and filtered via 0.45 μm filter (Roth/Millipore). Virus was concentrated using 20% sucrose and ultracentrifugation at 24,000 rpm (Beckman SW28 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... 2×106 cells were combined with 300 µL of virus and 0.8 µL/mL polybrene (Millipore, #TR1003G) in the well of a 12-well plate (final volume of 2 mL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10-15-Cas9 cells were infected with pooled CRISPR library virus using polybrene (8 µg/ml, Sigma) using a low multiplicity of infection (MOI = 0.75 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA from the supernatant of cell culture infected with the virus was isolated using the Trizol (Sigma) method described by the manufacturer ...
-
bioRxiv - Cancer Biology 2023Quote: ... NF1-MET cells were infected with 500 μL of 0.45 μm filtered virus with polybrene (EMD Millipore), and 48 hours post infection transduced cells were selected for by 2 μg/mL puromycin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... the virus was removed and replaced with normal growth medium containing 1 mg/ml puromycin from Sigma. The puromycin selection was used to kill off any uninfected control cells ...
-
bioRxiv - Microbiology 2023Quote: ... the virus suspension was replaced with 1mL/well of overlay medium (OM) containing 1% methylcellulose (Sigma, USA) in MM ...
-
bioRxiv - Microbiology 2024Quote: ... 100 TCID50 of the virus in Intesticult media supplemented with 500 μM sodium glycochenodeoxycholate (GCDCA; Sigma, G0759) was added to 5-day differentiated HIE monolayers in triplicate on a 96-well plate ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...