Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for 26S Proteasome Non ATPase Regulatory Subunit 11 PSMD11 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... The gene encoding for the α-subunit was cloned upstream of pETDuet-1 vector (Novagen) between the Nco I and Hind III sites with the gene of Strep-tag at the C-terminus ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-α1 GABAA receptor subunit (1:300; 06-868, Sigma-Aldrich, St. Louis, USA), guinea pig anti-α2 GABAA receptor subunit (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... following activation by ∼1 minute exposure to 300 nM bovine PKA catalytic subunit (Sigma P2645). Macroscopic currents were recorded at -20 mV ...
-
bioRxiv - Biophysics 2022Quote: ... in PBS for 10 minutes and blocked for non-specific antibody binding with 10% horse serum (Sigma-Aldrich) in PBS for 40 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... and subsequently stained with primary antibody overnight in 5% non-fat Milk in PBS + 0.05% Tween 20 (Sigma). The following primary antibodies were used ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were blocked in 5% BSA or 5% non-fat milk in TBST and incubated with primary antibodies (translin,1:100,000; FMRP, 1:10,000, Millipore) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: Trunks of 26-28 hpf embryos were incubated in Trypsin-EDTA solution (Sigma) at 28 °C for 15 minutes ...
-
bioRxiv - Immunology 2019Quote: ... Alexandra Trkola) were double labeled with PKH-26-cell membrane dye (Sigma-Aldrich) and a cytoplasmic-staining dye (Vybrant CFDA SE Cell Tracer Kit ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed and detached using a cell dissociation solution non-enzymatic (non-trypsin) (Sigma-Aldrich). Cells were resuspended to individual cells in 2mL of binding buffer (10mM HEPES ...
-
bioRxiv - Biophysics 2021Quote: ... A non-targeting shRNA (Sigma SHC216) was used as a control.
-
bioRxiv - Cell Biology 2020Quote: ... Non-O-methylated (cat# 551476, Millipore)
-
bioRxiv - Immunology 2022Quote: ... 1x non-essential amino acids (Sigma), 1x sodium pyruvate (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... 1x non-essential amino acids (Sigma), 1x sodium pyruvate (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... control non-TRE: 5’CCTGCGTAGTTCCATAAGGATAGC (Sigma).
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... 1% non-essential amino acids (Sigma), 0.05 mM β-mercaptoethanol (Gibco ...
-
bioRxiv - Developmental Biology 2020Quote: ... active (non-phosphorylated) β-catenin (Millipore) diluted 1:50 in Duolink Antibody Diluent at 4°C overnight then washed 2X 5 min in Duolink Wash Buffer A ...
-
bioRxiv - Bioengineering 2019Quote: ... non-essential amino acids (Sigma-Aldrich), B27 (Life Technologies) ...
-
bioRxiv - Cancer Biology 2019Quote: ... pLKO.1-non-targeting shRNA (Sigma; 5’- CCT AAG GTT AAG TCG CCC TCG CTC GAG CGA GGG CGA CTT AAC CTT AGG -3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... X1 non-essential amino acids (Sigma) and 1mM sodium pyruvate (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... non-mammalian shRNA sequences (Sigma SHC002) were cloned into Tet-pLKO-puro vectors by using oligo (5’-3’) ...
-
bioRxiv - Immunology 2021Quote: ... and non-essential amino acids (Sigma), plus anti-mouse CD3 (clone 145-2C11 ...
-
bioRxiv - Neuroscience 2020Quote: ... non-targeted shRNA (SHC016, Sigma-Aldrich), or empty vector plko.1 lentivirus ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1% non-essential amino acids (Sigma), 1% sodium pyruvate (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Non Essential Amino Acids (Sigma)) and passed through a 40 μm filter to remove non homogenous tissue ...
-
bioRxiv - Biochemistry 2022Quote: ... 1×non-essential amino acids (Sigma) and with 2i inhibitors (1 μM PD32591 and 3 μM CHIR99021 ...
-
bioRxiv - Microbiology 2019Quote: ... 1% non-essential amino acids (Sigma) and 1% tryptose phosphate (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... non-fluorescent pellet paint (Millipore, 70748) and ethanol precipitation ...
-
bioRxiv - Microbiology 2019Quote: ... 1% non-essential amino acids (Sigma), and 55 µM β-mercaptoethanol (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% non-essential amino acids (Sigma) and 2mM L-glutamine.
-
bioRxiv - Microbiology 2021Quote: ... 1% non-essential amino acids (Sigma), 1% glutamine (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... A non-target shRNA (shNT) (Sigma MISSION shRNA non-mammalian control SHC002 ...
-
bioRxiv - Bioengineering 2022Quote: ... 10% non-dialyzed FBS (Sigma, F2442) and 1% penicillin/streptomycin (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... 1% non-essential amino acids (Sigma) and 1% tryptose phosphate (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... non-essential amino acids (Sigma M7145), and antibiotics (penicillin/ streptomycin ...
-
bioRxiv - Neuroscience 2022Quote: ... Control non-targeting shRNA (Sigma, SHC002), and shRNAs targeting Mmp24 and Pcdhαc2 were obtained from Sigma (Mmp24 shRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% non-essential amino acids (Sigma), 1% L-glutamine (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-essential amino acids (Sigma, M7145) and 10 ng/ml FGF-2 (Peprotech ...
-
Functional characterization of ATP13A2 variants associated with distinct neurodegenerative disordersbioRxiv - Molecular Biology 2023Quote: ... 1% non-essential amino acids (Sigma), 1% sodium pyruvate (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... non-essential amino acids (1%, Millipore), human recombinant fibroblast growth factor 2 (FGF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% non-essential amino acids (Sigma), 2 mM L-glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... non-essential amino acids (Sigma, #M7145), sodium pyruvate (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100×non-essential amino acids (Millipore), 100×nucleosides (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... 1% non-essential amino acids (Sigma), and 10% heat inactivated fetal bovine serum (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... MEM Non-Essential Amino Acids (Sigma), 0.5µg/ml cycloheximide] ...
-
bioRxiv - Microbiology 2024Quote: ... 1% non-essential amino acids (Sigma), and 10% heat inactivated fetal bovine serum (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... 1% non-essential amino acids (Sigma), penicillin-streptomycin (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 90 µl of clear supernatant from each sample was transferred into each well of a 96-well black plate and proteasome activity was measured using Suc-LLVY-AMC substrate (Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... Assay buffer composition is same as lysis buffer only supplemented with ATP (2 mM) and proteasome substrate (100 μM, Suc-LLVY-AMC, Sigma). AMC fluorescence released by cleavage of substrate by proteolytic activity was recorded in a black 96-well plate after 60 min incubation at 37°C using the Victor 3V Multilabel counter (Perkin Elmer) ...
-
bioRxiv - Physiology 2021Quote: ... cells were treated with poly(I:C) (1.5 μg/mL for 4 hrs) and a combination of proteasome inhibitor (Bortezomib, 2 μM, Sigma/Calbiochem 5043140001) and prolyl endopeptidase inhibitors (Pramiracetam 10 uM ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were incubated with the proteasome blocker carbobenzoxy-L-leucyl-L-leucyl-L-leucinal (1 µM, MG-132, Sigma-Aldrich). After 2.5 h cells were additionally treated with the synthesis blocker cycloheximide (10 µg/mL ...