Labshake search
Citations for Millipore Sigma :
3801 - 3850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... 50µM Oligomycin (Millipore #495455-10MG), 100µM Carbonyl cyanide-p-trifluoromethoxy phenylhydrazone (TCI #C3463) ...
-
bioRxiv - Physiology 2024Quote: ... and 5µM Rotenone (Millipore #557368-1GM)/Antimycin A (Sigma #A674-50MG) are added to drug ports A ...
-
bioRxiv - Physiology 2024Quote: ... 1mM palmitate-BSA (#G7021, #P0500; Millipore-Sigma, St Louis, MO); inhibitors ...
-
bioRxiv - Physiology 2024Quote: ... with supplemented 10µL of 5mM pyruvate (Sigma #P2256-100G) and 10µL of 5mM malate (Cayman Chemical #20765) ...
-
bioRxiv - Physiology 2024Quote: The ATP content in LV or CM was measured using the ATP Assay Kit (Sigma-Aldrich; catalog number: MAK190) following the manufacturer’s instructions and using the Synergy HT spectrophotometer (Biotek) ...
-
bioRxiv - Physiology 2024Quote: ... 0.1mM palmitoyl carnitine (#P2256, #61251; Millipore-Sigma, St Louis, MO). At baseline and after each drug injection ...
-
bioRxiv - Physiology 2024Quote: ... and 1X MEM Non-essential Amino Acid Solution (Sigma; M7148). Approximately 96 hours post-transfection ...
-
bioRxiv - Physiology 2024Quote: ... cut in small pieces and digested at 37°C with collagenase A at 1mg/kg (Sigma-Roche, #10103578001) in Krebs - 1% BSA buffer during roughly 20 minutes ...
-
bioRxiv - Physiology 2024Quote: ... 50 μl of plasma and 0–12% D2O standards (Sigma, 151882) were placed into the inner well of an o-ring screw cap and inverted on heating block overnight at 80°C ...
-
bioRxiv - Physiology 2024Quote: ... diluted in corn oil (Sigma-Aldrich) was administered I.P ...
-
bioRxiv - Physiology 2024Quote: ... Media and cell AAV’s were combined and AAV’s were purified using an Iodixanol (Opti Prep Density Gradient Medium; Sigma-Aldrich #D1556250) gradient at 15% ...
-
bioRxiv - Physiology 2024Quote: ... HBECs were seeded directly onto human placental collagen (HPC, Sigma-Aldrich, C8374)-coated permeable supports (Costar Transwells ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Physiology 2024Quote: ... 1mM palmitate-BSA (#G7021, #P0500; Millipore-Sigma, St Louis, MO); inhibitors ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... for 2 min and then with 15 µM phospholipase C activator m-3M3FBS (525185, Sigma-Aldrich) for 2 min ...
-
bioRxiv - Physiology 2024Quote: ... Human male plasma was obtained from Sigma (H4522 ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... cells were stimulated in Ca2+-free solution with 1 μM Tg and 10 µM dantrolene (251680, Sigma-Aldrich) for 2 min and then with 15 µM phospholipase C activator m-3M3FBS (525185 ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... STIM1 (AB9870, 1/250 for IF and 1/1000 for WB) from Millipore; Orai1 (PA5-26378 ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... loaded with 2 μM of Fura-2 AM (F1221, ThermoFischer Scientific), 0.1 % pluronic acid (Pluronic F-127, P3000MP, ThermoFischer Scientific) and 40 µM of BTS (203895, Sigma-Aldrich) in the dark at room temperature for 60 min ...
-
bioRxiv - Physiology 2024Quote: 5 µm sections were stained with Picrosirius red (Sigma Aldrich, St ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... Neurofilament 200 (N4142; 1/2000 for IF) from Sigma; Synaptophysin (GT2589 ...
-
bioRxiv - Physiology 2024Quote: ... Immediately prior to the assay the media was changed to glycolytic stress test medium (Sigma Aldrich D5030) supplemented with 143 mM NaCl and 2mM L-glutamine (Gibco 25030 – 081) ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... Cells were stimulated in Ca2+-free solution with 1 μM thapsigargin (Tg, T9033, Sigma-Aldrich) for 7 min ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... muscles were incubated for 60 min at 37°C with 0.2% collagenase type I (C0130, Sigma-Aldrich) in DMEM (41966 ...
-
mTORC1-dependent SOCE activity regulates synaptic gene expression and muscle response to denervationbioRxiv - Physiology 2024Quote: ... m-3M3FBS action on phospholipase C and IP3R was validated by showing the absence of response with 5µM Xestospongin C (X2628, Sigma-Aldrich). Basal Ca2+ corresponds to Ca2+ levels before the addition of any drugs ...
-
bioRxiv - Physiology 2024Quote: ... Human male plasma was obtained from Sigma (H4522; Sigma-Aldrich, Saint Louis, MO, USA) and contained 6 mM glucose.
-
bioRxiv - Physiology 2024Quote: ... LVS consisted of Dulbeccos’s Modified Eagle’s Medium (DMEM, Sigma, Dublin, Ireland, catalog no. D6046) with Ficoll 70kDa (Sigma ...
-
bioRxiv - Physiology 2024Quote: ... Formamide (>99.5%, Sigma) was then added to each dried lung and incubated at 70°C for 1 h to extract Evans Blue dye ...
-
bioRxiv - Physiology 2024Quote: ... with Ficoll 70 kDa (Sigma, Dublin, catalog no. F2878) (33.8 g/l ...
-
bioRxiv - Physiology 2024Quote: ... with Ficoll 70kDa (Sigma, Dublin, catalog no. F2878) added (40 g/l ...
-
bioRxiv - Physiology 2024Quote: ... Bis-benzimide H 33342 trihydrochloride (0.1μg/ml, Sigma) was added to the secondary antibody for nuclear staining ...
-
bioRxiv - Physiology 2024Quote: ... insulin (0.75 U/Kg; Cat num. I9278, Sigma -Aldrich) was administered by intraperitoneal (IP ...
-
bioRxiv - Physiology 2024Quote: ... Primary antibodies were used at described dilutions in 3% bovine serum albumin (BSA; Sigma-Aldrich) in Tris-buffered saline with Tween 20 and incubated overnight (4°C) ...
-
bioRxiv - Physiology 2024Quote: ... Blocking was performed with 5% w/v BSA (Sigma), 5% goat serum ...
-
bioRxiv - Physiology 2024Quote: ... The washed epithelium was digested in 10 mL of digestion buffer (HBSS with 0.3 mg/mL dispase II [Sigma] and 0.2 mg/mL DNaseI [Sigma]) at 37°C for 8 minutes ...
-
bioRxiv - Physiology 2024Quote: ... Blocking was performed with 5% w/v BSA (Sigma), 5% goat serum ...
-
bioRxiv - Physiology 2024Quote: ... antigen retrieval was performed following rehydration by incubating with 0.8% hyaluronidase (Sigma-Aldrich) at 37°C for 30 min and antigen retrieval buffer (100 mM Tris ...
-
bioRxiv - Physiology 2024Quote: ... and 5 μM Y-27632 (Sigma). Cells were plated onto glass coverslips precoated with 5% Matrigel solution ...
-
bioRxiv - Physiology 2024Quote: ... Sections were dried and denatured for 10 min at 80°C in hybridization buffer (0.1M Tris, pH 7.2, 25mM MgCl2, 70% formamide [Sigma-Aldrich, Saint Louis ...
-
bioRxiv - Physiology 2024Quote: ... and 500 μM ADP-ribose (Sigma).
-
bioRxiv - Physiology 2024Quote: ... electrode tips were dipped in a solution of polyvinyl-chloride in tetrahydrofuran (10 mg in 3 mL; Sigma) to prevent ionophore displacement ...
-
bioRxiv - Physiology 2024Quote: ... the excess of reagents was eliminated by performing several washing steps with Milli-Q water using 4 mL cellulose membrane centrifugal filters (Amicon, MilliPore, 100 kDa, Merck). All MNP suspensions were sterilised by filtration using 0.22 μm MilliPore® filters before addition to cell cultures ...
-
bioRxiv - Physiology 2024Quote: ... 25 µM AK-1 (EMD-Millipore), 10 µM SirReal2 (Tocris) ...
-
bioRxiv - Physiology 2024Quote: ... to chelate reactive oxygen species [ROS]; 10 mM for 20 min, from a 0.5 M stock in distilled water, Sigma-Aldrich); and diphenyleneiodonium (DPI ...
-
bioRxiv - Physiology 2024Quote: ... Plasmids containing these shRNAs were obtained from Sigma (St. Louis, MO). We determined that the targeting sequence CCGTCCCTACATGGATGAAAT was most efficient in knocking down mTOR in primary human trophoblast cells ...
-
bioRxiv - Physiology 2024Quote: ... 100 µM NMN (Sigma), or combinations of the above as indicated under various glucose concentrations (5 mM ...
-
bioRxiv - Physiology 2024Quote: ... cells were seeded on glass slides (1.0×104 cells/well) in 24-well plates coated with 0.1 % gelatine and fixed with 4 % paraformaldehyde (PFA, Sigma-Aldrich) for 20 min at RT ...
-
bioRxiv - Physiology 2024Quote: ... mouse-anti-β-tubulin (Sigma T5201, 1:1000). Western blot secondary antibodies included ...
-
bioRxiv - Physiology 2024Quote: ... mouse anti-β-actin monoclonal antibody (clone AC15) from Sigma (A5441), and mouse anti-p36/MAT1 monoclonal antibody from BD Biosciences (#610532).
-
bioRxiv - Physiology 2024Quote: ... A dilution of 1:1,000 protease and phosphatase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO) was added to the solution ...