Labshake search
Citations for Millipore Sigma :
3651 - 3700 of 10000+ citations for 6 METHOXY 1 2 3 4 TETRAHYDRO NAPHTHALENE 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... animals of similar age were depleted of AID::GFP expression by culturing for 2 h on NGM plates containing 100 µM auxin (3-indoleacetic acid; Sigma). Directly after depletion ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Bioengineering 2023Quote: ... 3 µL of 2 M CaCl2 and 5 µL of 10 mg/mL ε-aminocaproic acid (ε-ACA) (Sigma-Aldrich), and 1 µL of 1U/µL Thrombin (MP Biomedicals ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were inoculated in YEP containing 3% lactic acid and treated with a final concentration of 2% galactose (Sigma-Aldrich). For the inducible degradation of the proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mm3 tissue pieces from 2-3 brains were pooled and enzymatically digested in a dissociation medium containing 0.16 mg/mL cysteine (Sigma C9768), 7 U/mL Papain (Sigma P3125) ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... The activity of trypsin was inhibited by dropping the pH to 2-3 by the addition of 10% trifluoroacetic acid (TFA, Sigma). The samples were loaded on Evosep tips to separate the digested peptides using nanoflow reversed-phase chromatography with an Evosep One liquid chromatography (LC ...
-
bioRxiv - Plant Biology 2024Quote: Arabidopsis Ws-2 CCR2::LUC WT seeds were surface sterilized and plated on 1x MS medium containing 3% w/v sucrose (Sigma), 1.5% w/v phytoagar (Duchefa) ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 3 days at 4°C with rabbit anti-AVP (1:2,000, Sigma, PC234L) or rabbit anti-Ntng1 (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were passaged at 1/8 ratio every 3 or 4 days with Accumax (Millipore, ref. SCR006).
-
bioRxiv - Biochemistry 2019Quote: ... 3 µl 16 mM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma-Aldrich) prepared in 20% DMSO and 80% t-butanol (Sigma) ...
-
bioRxiv - Plant Biology 2021Quote: ... 600 μl 4% acetic acid with 20 μl 1mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX, Sigma) and 0.6 μl 1mM spike control 8-Br-2′,3′-cAMP (Biolog ...
-
bioRxiv - Microbiology 2022Quote: ... XTT (sodium 3′- [1- (phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4- methoxy6-nitro) benzene sulfonic acid hydrate) (Sigma-Aldrich), according to the manufacturer’s recommended specifications ...
-
bioRxiv - Microbiology 2024Quote: ... at different concentration (1:1, 1:2, 1:10), 0.05% Tween-20 (BP337-100, Fisher BioReagents™) or 1% BSA (A6003, Sigma-Aldrich), was added on top of the concentrated spore suspension ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) was initially added in HBSS buffer to enhance baseline Ca2+ signals ...
-
bioRxiv - Cell Biology 2022Quote: ... 14-3-3 (Millipore AB9748-I, 1:2000); TOPO II (Abcam 109524 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... tubes were filled and replenished with a solution of 1 x 10-5 M abscisic acid (2-cis,4-trans-Abscisic Acid, 98%; Sigma-Aldrich; St. Louis MO, USA; product 862169). For the FC experiment ...
-
bioRxiv - Bioengineering 2021Quote: ... and 6-mercapto-1-hexanol (6-MCH) were purchased from Sigma-Aldrich. A diluted 1X saline-sodium citrate (SSC ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guts were stained in a 6:4 dilution of OilRedO (Sigma-Aldrich, 0.1% stock solution diluted in isopropanol ...
-
bioRxiv - Genomics 2020Quote: ... The epithelial layer was isolated from the underlying stroma and separately digested at 37°C for 2 hours with 2 mL of 1 mg/mL collagenase A (Sigma-Aldrich Corp., St. Louis, MO, USA) in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... we pumped ∼3-6 liters of fluid through 0.22 µm Sterivex filters (Millipore) on the seafloor ...
-
bioRxiv - Bioengineering 2024Quote: ... 3 IU/ml EPO Eprex (Janssen-Cilag) and 10−6 M hydrocortisone (Sigma). During the second phase (day 6 to day 9) ...
-
bioRxiv - Immunology 2023Quote: ... and developed using 2,2-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) substrate (Sigma). All antibodies are listed in Table S5.
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Cell Biology 2019Quote: ... the cell pellet was resuspended in 2 ml of 2 mg/ml collagenase IA (Sigma Aldrich) in PBS and incubated for 1 h at 37 °C on a horizontal shaker at 100 rpm ...
-
bioRxiv - Physiology 2019Quote: ... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES, Sigma Aldrich Cat. No# SML0601) was used at a concentration of 20μM for 1 hour in low (5 mM ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected approximately 2 μL of DNA (2 μg/μL) mixed with 0.1% Fast Green (Sigma) in PBS into a lateral ventricle of the embryonic brain with a pulled glass micropipette ...
-
bioRxiv - Plant Biology 2019Quote: ... resuspended in 2 ml of BY-2 medium supplemented with 150 µM acetosyringone (D134406, Sigma-Aldrich) and incubated at 28°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-chloro-2′-deoxyuridine (CldU) and 5-Iodo-2′-deoxyuridine (IdU) were obtained from Sigma-Aldrich. Click-iT EdU Alexa Fluor 488 Imaging Kit was obtained from Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: HUVECs were purchased from Lonza and cultured in Endothelial Cell Basal Medium (EBM-2) supplemented with 2% fetal calf serum (Sigma) and the following growth factors ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended at 2 × 107 / ml and incubated with 2 µg / ml anti BrdU antibodies (Sigma B8434) for 2 hrs at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... HDI crosslinker (#52649) and 2-(trifluoromethyl)phenyl isocyanate (2-TPI) (#159379) were purchased from Sigma Aldrich. N,N-dimethylformamide (DMF ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein sample (400 μg) was reduced by adding 2 μl of Tris(2-carboxyethyl)phosphine (Sigma) and incubating samples at 60 °C for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... The retinas were dissected and embedded in 2% low melting agar (2-hydroxymethyl agarose, Sigma Aldrich), mounted on a vibratome (DSK Microslicer ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 2 buffer with 25% w/v (2-hydroxypropyl)-β-cyclodextrin (HP-β-CD, Sigma-Aldrich). Treatments were aliquoted into single and combined daily doses and frozen at -80 ºC ...
-
bioRxiv - Developmental Biology 2024Quote: ... which was prepared as a 100% (w/v) stock solution in 2-methyl-2-butanol (Sigma), diluted 1:40 in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were incubated for 2 hours at room temperature with 2% normal donkey serum (Sigma, G6767) in PBS overnight at 4 °C with c-Fos primary antibodies (226003 ...
-
bioRxiv - Microbiology 2024Quote: ... 2-hydroxyibuprofen (2-OH-IBU) and carboxyibuprofen (CBX-IBU) were obtained from Sigma-Aldrich (Steinheim, Germany). All chemicals and solvents used were of the highest purity available.
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was applied on an already equilibrated 2-(2-pyridyl)ethyl columns (Sigma 54127-U) with 1 ml of 50% MeOH with 2% acetic acid ...
-
bioRxiv - Plant Biology 2023Quote: ... 2% ß-mercaptoethanol and 2 tablets/10ml of complete EDTA free protease inhibitor (Sigma Aldrich, USA), 100μM E-64 cysteine protease inhibitor (Bera et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were deeply anesthetized with avertin (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) and transcardially perfused with PBS followed by 4% paraformaldehyde in PBS ...
-
bioRxiv - Neuroscience 2024Quote: Under Avertin anesthesia (2,2,2-tribromoethaol 1.25%, 2-methyl-2-butanol 0.78%; 20 µL/g, i.p.; Sigma Aldrich) male A2A-Cre and D1-Cre mice (≥ 8 weeks old) ...