Labshake search
Citations for Millipore Sigma :
3551 - 3600 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... protein G- sepharose beads (Sigma, Ref. P3296), GFP-Trap MA beads (Chromotek ...
-
bioRxiv - Biochemistry 2024Quote: ... A Lowry assay (Sigma - total protein kit) was used to determine protein concentrations before resolving samples on an SDS-PAGE gel and transferring to nitrocellulose membrane for immunoblotting ...
-
bioRxiv - Microbiology 2023Quote: ... or control protein OVA albumin (Sigma/A5503) were mixed with NL63 virus at MOI 0.1 (1:1 ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were transferred to PVDF membrane (Millipore) and blocked in 5% bovine serum albumin (BSA ...
-
bioRxiv - Plant Biology 2023Quote: ... PureProteome Protein A magnetic beads (30µL; Millipore) for 2 hr at 7 rpm at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... protein expression in E.coli Rosetta cells (Novagen) was induced with 0.5 mM IPTG (isopropyl-β-D-thiogalactopyranoside ...
-
bioRxiv - Plant Biology 2023Quote: ... After electroblotting proteins on nitrocellulose membrane (Millipore), protein blot analysis was performed using antiserum with specific antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of protein G Sepharose (Sigma) with Casp-8 (C20 ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were transferred onto PVDF membranes (Millipore). Membranes were blocked in 5 % protease-free BSA (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein was concentrated in an Amicon (Millipore) 15 mL centrifugal concentrator 3K MWCO to 4-5 mL ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein was concentrated in an Amicon (Millipore) 15 mL centrifugal concentrator 30K MWCO to 4-5 mL ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were transferred to PVDF (Millipore, IPVH00010) or Nitrocellulose (Sigma_Aldrich ...
-
bioRxiv - Genetics 2024Quote: ... and then incubated with primary antibodies (HIF-1α antibody, Cell Signaling 36169; TSPO antibody, ThermoFisher MA5-24844; Histone-H3 antibody, Millipore Sigma 05-499) diluted in the blocking buffer overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: Transcription of rDNA was monitored by revealing the incorporation of 5-Fluoro-Uridine in Nascent RNA (5-FUrd, Sigma). Cells were incubated in presence of 2mM 5FUrd for 20 minutes followed by fixation in 4% FA (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’ -UUUUCAUGCUACGCGUAGUUUUCUACGCG- 3’) with Cyanine 5.5 at the 5’-end was obtained from Millipore Sigma (USA). Prior to the reaction ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reagents used including 5-chloro-2′-deoxyuridine (CldU) and 5-Iodo-2′-deoxyuridine (IdU) were obtained from Sigma-Aldrich. Concentration and duration of treatment are indicated in the corresponding figures and sections.
-
bioRxiv - Developmental Biology 2019Quote: ... Retention time (3.8 seconds) for 5-HT were determined by a control 5-HT dilution of 1pM (Sigma-Aldrich). Results are stated as area under the curve (AUC ...
-
bioRxiv - Cell Biology 2021Quote: ... Agarose beads were heated at 95°C for 5 min in SDS sample buffer containing 5 % β-mercaptoethanol (Sigma). After SDS-PAGE and transfer to a nitrocellulose membrane with a 0.2 μm pore size (RioRad) ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were permeabilised using 1 mM EDTA pH 8.0 for 5 minutes before treatment with 5 μM nigericin (Sigma) or 5 μM valinomycin (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... they were stained in 5 mL of GUS staining buffer containing 5 μg of X-gluc (Sigma-Aldrich, USA). Images were photographed by a microscope (DM4000B equipped with a DFC490 camera ...
-
bioRxiv - Immunology 2020Quote: ... Similar procedures were used to characterize activated cells stimulated for 5 hr with PMA (5 ng/mL; Sigma-Aldrich) and ionomycin (500 ng/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... or a control vehicle (n=11; 5% ethanol, 5% Cremphor EL [C5135-500G; Sigma-Aldrich, Inc.], and 90% saline) 30 minutes before testing ...
-
bioRxiv - Microbiology 2021Quote: Adult female worms were incubated with 5 μM of 5’ cy3-labeled Bma-lad-2 siRNA 1 (Sigma Aldrich) for 24 hrs to evaluate uptake of siRNA into intestinal tract epithelial cells ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were given intraperitoneal (i.p.) injections with 150mg/kg 5-Fluorouracil (5-FU; Sigma) from a 50mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: ... 5 μL of the dye solution was added to 1 mL 5 mg/mL HI (91077C, Sigma-Aldrich, 95%) monomer solution ...
-
bioRxiv - Microbiology 2022Quote: ... these samples were incubated with lysozyme reaction buffer (0.8X PBS, 50 mM glucose, 5 mM EDTA, 0.1% Triton X-100, 5 mg/mL lysozyme (Sigma #L6876)) for 20 min at 37 °C and then washed three times with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO], Y-27632 10.5 µM [Sigma] ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 45 s for nuclear staining and blocked in 5% bovine serum albumin (BSA, Biowest) for membrane staining or 5% BSA-0.3% Triton-X (Sigma) for nuclear staining ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Neuroscience 2020Quote: ... Bacterial pellets of 20 OD600 units were lysed in 0.5 ml cold lysis buffer (50 mM Sodium-phosphate pH 8.0, 300 mM NaCl, 5% glycerol, 5 mM 2-Mercaptoethanol, 1 mM PMSF [Sigma]), RNase [0.01 mg/ml] ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Neuroscience 2022Quote: ... the cryosections were rinsed in PBS for 5 min and incubated with blocking solution (5% Normal Donkey Serum [Sigma-Millipore ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Immunology 2019Quote: ... Some experiments were performed with 5-A-RU/MG (5-A-RU and methyl glyoxal (MG, from Sigma-Aldrich) mixed at a molar ratio of 1:50 immediately prior to use) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A 5 µL aliquot for each time point was removed and quenched with 5 µL nuclease P1 (Sigma #N8630) in a 100 mM sodium citrate suspension (pH 4.7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... at 14:30 and 48 hours later with 5 IU of human chorionic gonadotropin (5 IU, hCG; EMD Millipore). At the time of hCG injection ...
-
bioRxiv - Microbiology 2020Quote: ... a sterile filter disk containing 5 µL of 5 mg/ml streptonigrin solution (Sigma, catalog # S1014, dissolved in DMSO) was placed in the center of the plate ...
-
bioRxiv - Systems Biology 2020Quote: ... Separations were performed at 40°C on a Discovery BIO wide pore C5-5 column (15 cm × 2.1 mm × 5 μm) from Millipore-Sigma with a paired Supelguard (2 cm × 4 mm × 5 μm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were cultured for 72 h and then cell death was measured using the tetrazolium dye (2,3)-bis-(2-methoxy-4-nitro-5-sulphenyl)-(2H)-terazolium-5-carboxanilide (XTT) assay (Sigma) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 7.5, 1% Triton X-100, 0.5% Digitonin, 5 mM EDTA, 0.2 mM PMSF, Protease Inhibitor Cocktail–P8340, Sigma-Aldrich), and centrifuged at 16,200 g 4°C for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were blocked during 1 hour with TBS 0,1% Tween containing either 5% low-fat milk or 5% BSA (Sigma). Primary antibodies were diluted in TBST 0,1%Tween with 3% blocking agent ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS (pH 7.4) and incubated in 10 ml PBS (pH 7.4) containing 5 mM catalyst 5-methoxyanthranilic acid (Sigma Aldrich) and the ligand coupled to HATRIC ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of culture was incubated for 5 minutes at 37°C with 5 μg/ml of nile red (Sigma) to stain the membrane and the cell wall was labeled with 1 μg/ml of an equal mixture of vancomycin (Alfa Aesar ...
-
bioRxiv - Plant Biology 2022Quote: A stock of 5-(and-6)-carboxyfluorescein diacetate (CFDA) was prepared by dissolving 5 mg/ml CFDA (Sigma Aldrich) in acetone ...
-
bioRxiv - Immunology 2024Quote: ... 5-OP-RU was produced by combining a 5 µl stock solution of 32 mM of 5-A-RU with a 5 µl 1:10 dilution from a 6.5 M stock solution of methylglyoxal (Sigma). This 5-OP-RU was then diluted 1:10 for injection into the mass spectrometer ...
-
bioRxiv - Bioengineering 2022Quote: ... PLL labeled with fluorescein 5-isothiocyanate (PLLFITC) and 5(6)-Carboxytetramethylrhodamine N-succinimidyl ester (Rhod) were purchased from Sigma.
-
bioRxiv - Microbiology 2023Quote: ... and incubated in blocking buffer (2,8 mM KH2PO4, 7,2 mM K2HPO4, 5% goat serum [Gibco, Billings, MT], 5% glycerol, 1% cold water fish gelatin [Sigma, St Louis ...