Labshake search
Citations for Millipore Sigma :
3501 - 3550 of 10000+ citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... 1.6μl of 20μM Preamp primer (5’-[Btn]TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNN*N, SIGMA) and 32.8μl of Nuclease free water) ...
-
bioRxiv - Biophysics 2020Quote: ... then incubated with a mix 9:1 poly-L-lysine:Alexa Fluor 546-labelled poly-L-lysine solution (0.1% or 0.01% w/v H2O, Sigma P8920-100ml ...
-
bioRxiv - Cell Biology 2022Quote: ... and treated with 1 mM L-Leucyl-L-Leucine methyl ester (hydrochloride) (LLOME) (no. L7393, Sigma-Aldrich) dissolved in dimethtyl sulfoxide (DMSO) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The L-lactate concentration was measured using a L-lactate Assay Kit (Sigma-Aldrich MAK329, Merck, France). 20 μL of pre-treated and 0.4 μm filtered feces samples were used for each reaction ...
-
bioRxiv - Biophysics 2020Quote: The cathepsin L enzymatic assay was carried out as follows: human liver cathepsin L (EMD Millipore 219402) was activated by incubating at reaction buffer (20 mM sodium acetate ...
-
bioRxiv - Microbiology 2021Quote: ... Purified CD4+ T cells were activated with 5 µg/mL phytohemagglutinin-L (PHA-L; Sigma-Aldrich, #11249738001) and 100 U/mL IL-2 (PeproTech ...
-
bioRxiv - Neuroscience 2022Quote: ... Inhibition of CSE production was accomplished by in vivo L-propargylglycine (L-PAG, 30mg/kg (Sigma-Aldrich) administered (i.p ...
-
bioRxiv - Plant Biology 2019Quote: ... plants were grown aseptically on 0.5X solid Murashige and Skoog medium (MS; 2.15 g/L, pH 5.7; Duchefa) supplemented with 0.5 g/L MES hydrate (Sigma) and 0.7% or 0.85% (w/v ...
-
bioRxiv - Biochemistry 2021Quote: ... and benzoyl-L-arginine-p-nitroanilide (L-BAPA) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Rabbit anti-trypsin antibody (Ab-200997 ...
-
bioRxiv - Cell Biology 2019Quote: ... and potato dextrose (PDA; potato dextrose broth [Sigma Aldrich #P6685] 24 g/L, agar 12 g/ L). All media were made with filter sterile seawater ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 84 mg/ml L-arginine (Arg0) and 146 mg/ml L-lysine (Lys0) (Sigma-Aldrich), 10% dialyzed fetal bovine serum (Gibco) ...
-
bioRxiv - Biochemistry 2022Quote: ... or “heavy” L-arginine-13C6-15N4 (Arg10) and L-lysine-13C6-15N2 (Lys8) amino acids (Sigma-Aldrich). Cells were grown in an SC medium supplemented with the appropriate lysine and arginine variants until reaching an OD600nm of approximatively 1.0 ...
-
bioRxiv - Developmental Biology 2023Quote: The chemical reagent used for this study was O-Phospho-L-serine (L-SOP; Sigma, P0878-10MG). Stock solutions were dissolved in H2O to a concentration of 1 mM ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% ADC (8.1g/l NaCl, 50g/l BSA Fraction V (Millipore Sigma, Billerica, MA, USA), 20g/l glucose) ...
-
bioRxiv - Immunology 2023Quote: ... Biotin-poly-L-lysine was produced by incubating 5 mg/mL poly-L-lysine hydrobromide (Sigma P6282) with 1.5 mM EZ-Link Sulfo-NHS-Biotin (TFS 21217 ...
-
bioRxiv - Microbiology 2023Quote: ... C6/36 cells were maintained at 28 °C in Leibovitz’s L-15 (L-15) medium (Sigma, L4386) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 4 µl internal standard (2 g/l L-2-aminoadipic acid, Sigma-Aldrich Chemie GmbH, Buchs, Switzerland), and 3.5 µl diethyl ethoxymethylenemalonate (VWR International AG ...
-
bioRxiv - Immunology 2024Quote: ... and the concentrations of extracellular L-lactate were measured using the L-Lactate Assay Kit (Sigma-Aldrich), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2024Quote: ... that was autoclaved before the final addition of L-cysteine hydrochloride (0.5 g/L, Sigma Aldrich C7477). Media and all consumables were allowed to reduce in an anaerobic chamber for >12 hours before use ...
-
bioRxiv - Cell Biology 2022Quote: ... and an N-hydroxysuccinimide-fibronectin solution prepared by combining 1 part N-hydroxysuccinimide solution (cat. no. A8060, Sigma-Aldrich; 1 mg/ml in dimethyl sulfoxide) and 9 parts fibronectin solution (cat ...
-
Dietary potassium and cold acclimation additively increase cold tolerance in Drosophila melanogasterbioRxiv - Physiology 2024Quote: ... the glass microelectrodes were heated to 300°C on a hot plate and silanized in an atmosphere of N,N-dimethyltrimethylsilylamine (Sigma Aldrich, Saint Louis, MO, USA) under an inverted ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Microbiology 2024Quote: ... strains were streaked from cryostocks on LB agar (10 g L-1 tryptone, CRITERION™, 5 g L-1 yeast extract, Sigma-Aldrich and 5 g L-1 NaCl) and incubated for 2 days at 30 °C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC; Sigma-Aldrich) were added drop-wise at 5000 molar equivalents to the alginate solution while stirring ...
-
bioRxiv - Neuroscience 2024Quote: ... The two odors used were 3-octanol (3-Oct) (Sigma-Aldrich 218405) and 4-methyl-cyclohexanol (MCH ...
-
bioRxiv - Neuroscience 2024Quote: ... a 3 mm-thick agar gel cap (Sigma, 3% in distilled water) was placed between the head and the surface coil ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: Nutlin-3 (Sigma, N6287) was dissolved in corn oil (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... 3% donkey serum (Millipore), and 0.2% Triton X-100 in PBS ...
-
bioRxiv - Genetics 2019Quote: ... 3 mM ATP (Sigma), 1 mM CaCl2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... pHistone 3 S10 (Millipore), pp53 S15 (Cell Signaling) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3% sucrose (Sigma-Aldrich), 0.8% Phytoagar (Duchefa) ...