Labshake search
Citations for Millipore Sigma :
3501 - 3550 of 10000+ citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... active and inactive NS2B(H)-NS3 pro proteases were generated as described previously and cloned into the MCS1 (multiple cloning site 1) of dual protein expression plasmid pETDuet-1 (Novagen, Beijing, China) through restriction sites EcoRI and NotI ...
-
bioRxiv - Bioengineering 2021Quote: ... Mature human white-like adipocytes were transfected in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522) to mimic the subcutaneous tissue environment ...
-
bioRxiv - Immunology 2020Quote: ... Plates were washed 6 times with washing buffer and then incubated with anti-human IgG (Jackson Immuno Research 109-036-088) or anti-human IgA (Sigma A0295) secondary antibody conjugated to horseradish peroxidase (HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated for 48 hours at 4°C with the following primary antibodies: anti-GBA (1:500; human 8E4; human and rodent G4171, Sigma-Aldrich), anti-human α-synuclein (syn211 ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection for mature human white-like adipocytes was performed in the presence of fresh BM-1 medium supplemented with 1% human serum (Sigma, H4522). Both HeLa cells and mature human white like adipocytes were transfected with LNPs at a final mRNA concentration of 1.25μg/mL ...
-
bioRxiv - Bioengineering 2024Quote: ... The immortalized Podo/Tert256 human podocyte hTERT cell line (Evercyte) was expanded in flasks coated with 6 µg/cm2 human collagen I (Sigma, C7774) at 37°C in MCDB131 basal media (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... The human ORF sequence encoding for GSDMD was obtained from the Viral Vector Facility (LUMC) human ORF (cDNA) library from Sigma-Aldrich. The gene ORF was obtained in pDONR223 entry vectors and amplified by PCR with overhang primers to introduce partial sequences of an N-terminal FLAG-tag and C-terminal Myc-tag ...
-
bioRxiv - Cell Biology 2024Quote: Human umbilical vein endothelial cells (HUVECs) were isolated from human umbilical cords using collagenase type I (Sigma-Aldrich, 400 U/mL) to separate the cell layer surrounding the vein lumen ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was prepared from a 3 ml culture of the representative strain using the GenElute ™ Bacterial Genomic DNA Kit (Sigma Aldrich, Sweden) [7].
-
bioRxiv - Cell Biology 2020Quote: Alkaline phosphatase activity (ALP) was determined staining samples with naphtol AS-MX/Fast Red TR (Sigma-Aldrich) for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... 1% NP-40 and 2 mM EDTA) supplemented with protease and phosphatase I and II inhibitors (Sigma–Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and osteoblast-specific alkaline phosphatase activity measured at 405 nm by using 120 mM p-nitrophenolphosphate (Sigma) in 0.1 M Tris buffer (pH 8.5) ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 mM EDTA and 0.5% NP-40) supplemented with phosphatase/protease inhibitor cocktail (MS-SAFE, Sigma-Aldrich) in a 4°C water bath using a sonicator (QSONICA ...
-
bioRxiv - Systems Biology 2019Quote: BMDM or tissue (kidney and liver) were lysed in presence of protease and phosphatase inhibitors (Sigma-Aldrich) spun (14000 g for 15 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... and after 7 days alkaline phosphatase staining was performed following the manufacturer’s instruction (Sigma, Cat#86R-1KT).
-
bioRxiv - Microbiology 2019Quote: ... polyclonal antibodies mentioned above and secondary antibody conjugated to goat anti-Rabbit IgG conjugated alkaline phosphatase (Sigma) and detected with NBT/BCIP (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... and then homogenized by sonication in lysis buffer containing 1% protease inhibitors and 1% phosphatase inhibitor (Sigma). The protein lysates containing 20 micrograms of protein were separated in 4-15% polyacrylamide gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... Sigma-Aldrich] and phosphatase inhibitors (1 mM NaF, 0,3 mM Na2P2O7 and 1 mM Na3VO4; Sigma-Aldrich). Cell lysates were collected and lysed for 30 min at 4°C in rotation ...
-
bioRxiv - Molecular Biology 2020Quote: ... which in turn was detected using 1:5000 goat anti-mouse IgG alkaline phosphatase conjugate (Sigma, A3562).
-
bioRxiv - Biophysics 2021Quote: ... followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma). Further purification was performed by ion exchange chromatography (Source Q for WT and the S897E ...
-
bioRxiv - Immunology 2022Quote: ... Plates were washed 4 times and substrate composed of phosphatase substrate tables (Sigma-Aldrich, St Louis, MO) diluted in 5 ml of diethanolamine buffer per tablet was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... The staining reaction was done in the alkaline phosphatase buffer containing 10% dimethylformamide and NBT (SIGMA, Germany) and BCIP (SIGMA ...
-
bioRxiv - Immunology 2022Quote: ... An anti-hamster IgG (H+L)-Alkaline Phosphatase antibody produced in goat (Sigma-Aldrich, St Louis, MO) diluted to 1:1000 in 3% BAS-PBS was added at 60 µl/well for 1 hour at room temperature ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... using either anti-mouse or anti-rabbit alkaline phosphatase-conjugated antibodies (A3562 or A3687, respectively; Sigma-Aldrich) diluted 1:7500 in TBS-5% ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 0.1% sodium dodecyl sulfate) supplemented with an EDTA-free phosphatase inhibitor cocktail 2 (Catalog #P5726, Sigma) and phosphatase inhibitor cocktail 3 (Catalog #P0044 ...
-
bioRxiv - Plant Biology 2020Quote: ... 20 mM EDTA and freshly supplemented with MS-SAFE Protease and Phosphatase Inhibitor Cocktail (Sigma Aldrich # MSSAFE) (e.g. ...
-
bioRxiv - Developmental Biology 2019Quote: ... in PBST and incubated overnight at 4°C with the alkaline phosphatase-conjugated anti-DIG antibody (Sigma) at a dilution of 1:5000 ...
-
bioRxiv - Immunology 2021Quote: ... bound antibodies were detected by addition of alkaline phosphatase (AP)-conjugated goat anti-mouse IgG (Sigma-Aldrich) or anti-mouse IgM (Abcam ...
-
bioRxiv - Physiology 2021Quote: ... Frozen heart samples were homogenised in hepes-tris buffered saline with protease and phosphatase inhibitors (Sigma Aldrich). Samples were then loaded in Laemmli buffer ...
-
bioRxiv - Physiology 2021Quote: ... and 0.25% sodium deoxycholate) supplemented with a protease inhibitor mixture (Nacalai Tesque) and phosphatase inhibitor mixture (Sigma). Protein concentration was determined by BCA Protein Assay (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Then cells were lysated with 1.5 ml 1x Sabatini lysis buffer (Phosphatase Inhibitor Cocktail 2 (P5726, Sigma), Phosphatase Inhibitor Cocktail 3 (P0044 ...