Labshake search
Citations for Millipore Sigma :
3501 - 3550 of 10000+ citations for Contactin Associated Protein Like 3 CNTNAP3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: Zygotes were de-jellified using 3 % cysteine (Merck Millipore, USA), washed 6 times in N ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS, Millipore Sigma), 0.3% N-lauroyl sarcosine (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... Apoptosis was induced by adding 3 µM staurosporine (Sigma Aldrich) for 4 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and DNase I (#69182–3; Sigma Aldrich, 10 U/ml) for 2 hours at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3% v/v heat-inactivated Human Male AB Serum (Sigma), 2 mg/ml Human Serum Albumin (HSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... *Rabbit anti-caspase 3 active cleaved (1:1000, AB3623, Millipore).
-
bioRxiv - Immunology 2023Quote: ... and mixed with 20 μL of 0.15% 3-hydroxydiphenol (Sigma) in 0.5% NaOH ...
-
bioRxiv - Molecular Biology 2023Quote: ... Calu-3 cells were cultured in Advanced DMEM (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were blocked with 3% donkey serum (Millipore Sigma, D9663) in PBS for 2 hours at room temperature and incubated overnight at 4°C using the following concentrations ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μL of 3 mg/mL Collagenase (Sigma-Aldrich, C6885) was added to the supernatant and the mixture was incubated at 37°C for 45 minutes under constant shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... After blocking with a 3% goat serum (Sigma-Aldrich – S26) solution in PBS for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 µM 3-Isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich #I5879), and 1 µM dexamethasone (Gbiosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... using 3:1 polyethylenimine (average Mw, ∼25,000 Da; Sigma-Aldrich) to total DNA ratio (4 μg BRSK and 2 μg TAU DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... and phase-separated in 1-bromo-3-chloropropane (B9673, Sigma) [82,95] ...
-
bioRxiv - Neuroscience 2024Quote: D-4-amino-3-isoxazolidone (DCS, C3909 Sigma-Aldrich, UK) was prepared in sterile saline solution (6) ...
-
bioRxiv - Neuroscience 2024Quote: ... permeabilized for 30 min with 3% Triton-X (Millipore Sigma) in 1x PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μM Nigericin (Sigma-Aldrich, N7143, CAS: 28643-80-3), 2.5 μM Saliphenylhalamide (Salip ...
-
bioRxiv - Biophysics 2024Quote: ... 500 mM 3-(1-Pyridin)-1-Propansulfonat (NDSB-201; Sigma) for protein stabilisation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3% bovine serum albumin (w/v) (Sigma, A-7888) at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocked (3% BSA (Bovine Serum Albumin, Sigma-Aldrich #A7030) and 0.1% Tween (Sigma-ldrich)) ...
-
bioRxiv - Cancer Biology 2024Quote: 3% poly-2-hydroxyethyl methacrylate (poly-HEMA; P3932, Sigma-Aldrich) solution was prepared in 95% absolute ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 purchased from Sigma Aldrich, MO ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by endogenous peroxidase inactivation with 3% H2O2 (Sigma-Aldrich) and subsequently blocked in 5% BSA in TBS-T with TBS washes inbetween each step ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM DTT supplemented with 3 mM ATP (Sigma) and 3 mM MgCl2 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... and IBMX (3-Isobutyl-methylxanthine, 25µM, Sigma-Aldrich, Toluca Mexico) with ACSF was perfused for 25min ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Immunology 2024Quote: ... 0.3% Triton X-100 and 3% Bovine Serum Albumin (Sigma). Cells were stained with antibodies for 30m-1h at room temperature or up to overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Phase separation was achieved with 1-bromo-3-chloropropane (Sigma), and the resulting aqueous phase was precipitated in isopropanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 mM MgCl2) containing 250 U/ml Benzonase (Sigma, E1014), 1X cOmplete EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Physiology 2024Quote: ... stimulated with nicotine (Sigma Cat. # 6019-06-3, 50μg/ml), nicotine + angiotensin II (Tocris Cat ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by coating with 3 mg/ml Concanavalin A (Sigma) for 1 hour at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 mM 3-mBz (m-toluic acid, Sigma-Aldrich) to induce msfGFP production ...
-
bioRxiv - Genomics 2024Quote: ... 3) 30 seconds in Harris’ modified Haematoxylin solution (Sigma HHS16), 4 ...
-
bioRxiv - Microbiology 2024Quote: ... 50mg 3-(Acrylamido) phenylboronic acid (Sigma Aldrich Cat No. 771465), 1ml 10X RNase-free TAE ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2024Quote: ... a 2% 3-(Trimethoxysilyl)propyl methacrylate (TMSPMA, Sigma-Aldrich 440159) (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... the substrate was treated with (3-Aminopropyl) triethoxysilane (Sigma-Aldrich), diluted at 5% in absolute ethanol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Primary antibodies were diluted in Duolink Antibody Diluent (Sigma) and incubated overnight at 4°C (See above) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies used: anti-puromycin antibodies (Millipore Cat#MABE343), anti-alpha-tubulin (Sigma Cat# T5168) ...
-
bioRxiv - Cell Biology 2021Quote: Primary antibodies used: anti-Flag M2 antibody (F1804, Sigma), anti-mouse Pericentrin (611814 ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibodies used were: mouse anti-Olig2 antibody (Millipore, MABN50), rabbit anti-H3K4me3 antibody (Active motif ...
-
bioRxiv - Cell Biology 2020Quote: ... pan-polyglycylated antibody (mouse monoclonal antibody, AXO49, MABS276 Millipore), monoglycylated antibody (AXO 962 mouse monoclonal MABS277 ...
-
bioRxiv - Plant Biology 2021Quote: ... against a primary antibody (GST-tag Monoclonal antibody, Novagen), which is attached to GST-tagged TF proteins (Figure S4).
-
bioRxiv - Plant Biology 2020Quote: ... For secondary antibodies anti-mouse antibody (Sigma-Aldrich, UK), anti-rabbit (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The primary antibodies used were αSMA antibody from Sigma. The Aperio ScanScope XT Slide Scanner (Aperio Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... Primary antibodies: anti-LC3 antibody Atg8 (Merck Millipore #ABC975) (1:1000) ...
-
bioRxiv - Neuroscience 2022Quote: ... The primary antibodies used were: rabbit anti-Barhl1 polyclonal antibody (Atlas Antibodies, HPA004809, Sigma, 1:500), goat anti-Robo3 polyclonal antibody (R&D Systems ...
-
bioRxiv - Plant Biology 2020Quote: ... The protein amount of the resuspended membrane fractions was quantified by Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich) and equilibrated between different samples ...
-
bioRxiv - Plant Biology 2021Quote: ... Total protein was measured using the protein extract for PEPCK activity using Bradford reagent (Millipore Sigma; Cat: B6916) and commercial bovine serum albumin standards (Thermo Fisher 23208) ...