Labshake search
Citations for Millipore Sigma :
3451 - 3500 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 50,000 MBS-MEFs were seeded in 6-well plates and exposed to the virus particles mentioned above in serum-free media supplemented with 6 µg/ml polybrene (Sigma). Cells with high or low expression of tdTomato were selected by FACS (BD Biosciences Aria III).
-
bioRxiv - Biophysics 2022Quote: ... in this work referred to as Pif1) fused at its N-terminus to a 6-histidine tag was cloned into vector pET28 (Novagen) and transformed into E ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were grown to near confluency on 6 cm dishes and total RNA was extracted using the RNAzol RT reagent (Sigma) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Excision of the GFP cassette in blood stage parasites was monitored by flow cytometry using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore) to detect GFP and mCherry ...
-
bioRxiv - Genomics 2022Quote: ... Cross-links were reversed by incubating the eluted samples and inputs at 42°C for 2 hours and 67°C for 6 hours in the presence of Pronase (Sigma) and TE buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... were separated on 0.1% SDS polyacrylamide gels (6–12% w/v depending on the molecular mass of protein) and electroblotted onto Immobilon-PVDF Transfer Membrane (Merck Millipore). Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin ...
-
bioRxiv - Microbiology 2020Quote: 2 μg mRNA suspended in 6 μl RNAse-free H2O was digested with 2 units of nuclease P1 (Sigma N8630) for 3 h at 37 ºC ...
-
bioRxiv - Neuroscience 2021Quote: ... the samples were mounted in polyvinyl alcohol-based mounting medium containing 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; FUJIFILM-Wako) and 2.5% (w/v) 1,4-diazabicyclo[2.2.2]octane (Sigma, St. Louis, MO, USA) as an antifade ...
-
bioRxiv - Neuroscience 2021Quote: ... one day after the apomorphine-induced rotation test the rats were administered daily 6 mg/kg L-DOPA (Sigma Aldrich) and 15 mg/kg benserazide HCl (purchased from the Chinese domestic market) ...
-
bioRxiv - Biochemistry 2021Quote: ... from Arthrobacter ureafaciens (cat # 10269611001) and α2-6-sialyltransferase from Photobacterium damsela (Pd2-6ST, cat # S2076) were purchased from Sigma. CMP-Neu5Ac (cat # 233264 ...
-
bioRxiv - Neuroscience 2022Quote: ... HeLa cells were rinsed with PBS and cultured in the normal culture medium supplemented with 100 μM 6-aminonicotinamide (Sigma) (6AN ...
-
bioRxiv - Neuroscience 2022Quote: ... and four old (24-month old) male C57BL/6 mice were deeply anesthetized and perfused with cold PBS (Sigma, D8537). Each brain was carefully removed and individually micro-dissected under a dissection microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 μL of beads were washed with PBS and incubated with 6 μg of anti-FLAG antibody (Sigma-Aldrich, F1804) in PBS + 0.5% BSA at 4°C for 3 h with gentle rocking ...
-
bioRxiv - Microbiology 2022Quote: ... cells were replated in 6-well plates with RPMI medium containing 1mg/mL G-418 (Sigma-Aldrich, St. Louis, MO). As we described previously (52) ...
-
bioRxiv - Physiology 2022Quote: ... virgin female flies were collected within 6 h of eclosion and reared on standard medium supplemented with 1.5 mM methoprene (Sigma-Aldrich, St Louis ...
-
bioRxiv - Bioengineering 2019Quote: Substrates were placed into 6-well plates and both chambers were washed three times with 50 mM HEPES pH 8.5 (Sigma H3375). The polyacrylamide was activated for ECM protein coating by covering the substrates with 500 μL of 0.5 mg/mL sulfo-SANPAH (Proteochem c1111 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 25 μl Ad5CMVFlpO (6 × 1010 PFU/ml) was incubated with 600 μl minimum essential media (Sigma-Aldrich, St Louis, MO) and 3 μl 2 M CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 6 µl homogenate was mixed with 94 µl Glucose Oxidase (GO) reagent from the Glucose (GO) Assay Kit (Sigma, GAGO20) containing 1 µl (0.3 U ...
-
bioRxiv - Cell Biology 2019Quote: ... The sample was then cut in half with a clean razor and each piece was placed in a 6-well plate with 10 ml of ASW and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma) at a final concentration of μg/ml (or an equal volume of sterile diH2O ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Synthetic Biology 2020Quote: ... glass coverslips placed in 6-well plates were coated in a 0.1 mg/mL solution of poly-L-lysine hydrobromide (Sigma #P6282) for 5 min and left to dry overnight before plating 6×105 cells per well in 2 mL DMEM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Pathology 2021Quote: ... rats in the high-dose 7-d L-DOPA priming group (n=6) were treated daily with L-DOPA (12 mg/kg) + benserazide (15 mg/kg, s.c., Sigma-Aldrich) for 7 d (i.e. ...
-
bioRxiv - Cell Biology 2019Quote: ... and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore, Tullagreen Carrigtwohill Co.Cork ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was fused with an N-terminal His(6)-tag followed by maltose binding protein (MBP) tag and TEV cleavage site in pET21 vector (Novagen).
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Cell Biology 2020Quote: ... electroporated parasites were mixed immediately with 100 μl of reticulocyte-rich blood from a naïve mouse treated with phenylhydrazine (6 mg/ml) (Sigma-Aldrich), incubated at 37°C for 20 min and then injected intraperitoneally into another mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µg of RNA were separated on MEN-buffered 1.5% agarose gels that provided denaturing conditions by 6% formaldehyde using an RNA sample loading buffer containing a final concentration of 62.5% (v/v) deionized formamide (Sigma-Aldrich). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The enzyme reaction was started by the addition of 0.16 ml of 6 mM p- nitrophenyl β-D-glucuronide (Sigma) to the broken cells and stopped by the addition of 0.4 ml of 1.0 M NaCO3 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then analyzed on a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Microbiology 2020Quote: ... Cells were then fixed with 1% formaldehyde solution and analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Immunology 2021Quote: ... were characterized and fractionated by size exclusion chromatography using a Superose 6 10/300 GL on an AKTA liquid chromatography system and concentrated on AmiconUltra 100k spin columns (Millipore).
-
bioRxiv - Immunology 2020Quote: ... Eluate from amylose resin was concentrated and purified as a range of small oligomers on a Superose 6 size exclusion column (Cytiva) in lysis buffer, concentrated again (500 μL, A280 = 6) using a 50 kDa spin column (Millipore), and cleaved overnight with MBP-3C protease (50 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... were seeded at 200,000 cells/well of 6 well plates and transduced with lentiviral particles at final MOI of 0.5 with 8 µg/ml polybrene (Sigma-Aldrich). Transduced cells were selected in 10 µg/ml puromycin (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... then resuspended in complete DMEM for analysis by flow cytometry on a Guava EasyCyte 6/2L bench cytometer equipped with 488nm and 532nm lasers (Millipore). Control wells were prepared without sporozoites to measure the basal level of dextran uptake ...
-
The intestinal circadian clock drives microbial rhythmicity to maintain gastrointestinal homeostasisbioRxiv - Physiology 2022Quote: Complete GI transit time (GITT) was measured by administering natural carmine red (6%, SigmaAldrich) dissolved in 0.5% methylcellulose (Sigma-Aldrich) by gavage (100ul ...
-
bioRxiv - Cancer Biology 2022Quote: ... see Figure S1A and 22) added to the cells with 400 µg/ml of poloxamer-407 (Sigma, 9003-11-6) and incubated in a 37°C CO2 incubator for another 24 hours (Figure 1A) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2.5×105 B16-F10 cells were plated into a 6-well dish and stimulated with growth media supplemented with 10 or 20 μM forskolin (Sigma) and 100 μM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Biochemistry 2022Quote: ... with 3% BSA and incubated with the 3% BSA-blocked blotted membrane at 4 °C overnight in the absence or presence (as a negative control) of 10 mM free mannose-6-phosphate (M6P) (Sigma). The membranes were then washed three times with TBST (1×15 min and 2x 5min washes ...
-
bioRxiv - Developmental Biology 2022Quote: ... A few hours later the cells were infected with titer-adjusted volumes of each viral supernatant supplemented with 6 μg/ml (final concentration) of protamine sulfate (Sigma). After two days ...
-
bioRxiv - Cell Biology 2022Quote: NOD/SCID mice (6 weeks-old) were treated with an intraperitoneal (ip) injection of 650 mg APAP/kg (Sigma-Aldrich) to induce ALF ...
-
bioRxiv - Developmental Biology 2022Quote: ... The explants were cultured for 6 days in DMEM with 10% fetal bovine serum and 10 μg/ml ciprofloxacin (17850, Sigma), and then fixed in 4% PFA for 15min at room temperature before being processed for immunolabeling.
-
bioRxiv - Immunology 2022Quote: ... Lysates were assayed for phospho proteins using the Milliplex Cell Signaling kit (NFκB Magnetic Bead Signaling 6-plex, Millipore Sigma) for detection of NFκB pSer536 ...