Labshake search
Citations for Millipore Sigma :
301 - 350 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... EIF4E2 shRNA#2 (sh4EHP#2) (Sigma, TRCN0000280916) and EIF4E2 shRNA#3 (sh4EHP#3 ...
-
bioRxiv - Microbiology 2022Quote: ... GIGYF2 shRNA#2 (shGIGYF2#2) (Sigma, TRCN0000138937) and GIGYF2 shRNA#3 (shGIGYF2#3 ...
-
bioRxiv - Neuroscience 2021Quote: ... or the control shRNA vector (SHCOO2; Sigma) into HEK293T cells and collected 48hours later ...
-
bioRxiv - Biochemistry 2019Quote: ... the most effective UCHL1 shRNA (TRCN0000007273; Sigma) for lentiviral infection was used for the experiments.
-
bioRxiv - Cancer Biology 2020Quote: ... or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC; TRCN0000381243; Sigma), along with psPAX2 packaging and pMD2.G envelope plasmid DNA at a ratio of 4:3:1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... CALCRL MISSION shRNA (shCALCRL#1, Sigma-Aldrich, Cat# TRCN0000356798 ...
-
bioRxiv - Cancer Biology 2020Quote: ... E2F1 MISSION shRNA (Sigma-Aldrich, Cat# TRCN0000039659). List of shRNA sequences ...
-
bioRxiv - Cell Biology 2021Quote: ... We used MISSION shRNAs (pLKO.1; Sigma): TERF2 (TRNC0000004812) ...
-
bioRxiv - Microbiology 2022Quote: ... GIGYF2 shRNA#1 (shGIGYF2#1) (Sigma, TRCN0000135151), GIGYF2 shRNA#2 (shGIGYF2#2 ...
-
bioRxiv - Microbiology 2022Quote: ... and EIF4E2 shRNA#3 (sh4EHP#3) (Sigma,). GIGYF2 shRNA#1 (shGIGYF2#1 ...
-
bioRxiv - Microbiology 2022Quote: ... EIF4E2 shRNA#1 (sh4EHP#1) (Sigma, TRCN0000152006), EIF4E2 shRNA#2 (sh4EHP#2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA constructs were obtained from Sigma Millipore (control (SHC002) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA construct number TRCN000094248 from Sigma mouse TRC shRNA library was used for knockdown studies of mouse FMOD ...
-
bioRxiv - Cancer Biology 2022Quote: ... IRF3 shRNA-1 (Sigma-Aldrich, cat. TRCN0000005921); and IRF3 shRNA-2 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... or a mixture of control shRNAs (Sigma) and a puromycin-resistance gene using Oligofectamine (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: Lentiviral shRNAs for RIOK2 and IMP3 (Sigma, MISSION shRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... MISSION pLKO.1 lentiviral shRNA (MilliPORE Sigma) was used to knockdown Smad1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or a control shRNA (Sigma, cat#SHC002V). Murine 266-6 cells (ATCC cat#CRL-2151 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or shRNA against St6gal1 (Sigma, cat#TRCN00000018818). Stable polyclonal populations were isolated by puromycin selection.
-
bioRxiv - Genetics 2019Quote: shRNA sequences were obtained from Sigma-Aldrich in pLK0.1 lentivirus vector ...
-
bioRxiv - Microbiology 2021Quote: ... four shRNA hairpins were obtained from Sigma mission catalogue 3-1245h1C1 ...
-
bioRxiv - Cell Biology 2020Quote: ... MISSION shRNA constructs were obtained from Sigma in pLKO.1-puro vectors ...
-
bioRxiv - Cancer Biology 2020Quote: ... All shRNAs were obtained from Sigma Aldrich.
-
bioRxiv - Cancer Biology 2019Quote: Murine shRNA constructs were obtained from Sigma via the University of Colorado Functional Genomics Shared Resource (TRC1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or a control non-targeting shRNA (Sigma) as described above ...
-
bioRxiv - Immunology 2020Quote: ... RNF20 or CtIP+RNF20-specific shRNAs (Sigma) and then placed cells under puromycin selection (0.5 μg/ml) ...
-
bioRxiv - Immunology 2020Quote: ... pLKO shRNA targeting BBS1 (Sigma-Aldrich, #TRCN0000417688), pEGFP-N1-hBBS1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1-non-mammalian shRNA construct (Sigma, SHC002) was used as a control ...
-
bioRxiv - Cell Biology 2022Quote: pLKO-shRNA constructs were purchased from Sigma. The following shRNA sequences were used ...
-
bioRxiv - Cancer Biology 2024Quote: All shRNAs were obtained from Sigma-Aldrich. The TCRN are as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Non-targeted shRNA (Millipore Sigma Cat#SHC016) or 5-6 gene specific shRNA using 5-6 lentivirus transfer plasmids per gene target (see Key Resources Table ...
-
bioRxiv - Cancer Biology 2024Quote: ... MISSION® TRC shRNA Lentiviral Vectors (Sigma) were used.
-
bioRxiv - Cancer Biology 2023Quote: ... shINSR#2 (Mission TRC shRNA, TRCN0000000379, Sigma), shGLUT1 (Mission TRC shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... shIGFR1#2 (Mission TRC shRNA, TRCN0000000422, Sigma). For lentivirus production ...
-
bioRxiv - Cell Biology 2023Quote: All shRNAs were obtained from Sigma-Aldrich, except for the scramble shRNA which was obtained from Addgene (a gift from David Sabatini ...
-
bioRxiv - Neuroscience 2023Quote: ... or a non-targeting control shRNA (Sigma, SHC001 ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1 lentiviral shRNA (MilliPORE Sigma) was used to knockdown LOX or CXCL14 in 2H11 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following shRNAs were obtained from Sigma: HDAC2 (TRCN0000375947 ...
-
bioRxiv - Neuroscience 2024Quote: ... TRC mouse Mtmr2 shRNA (Sigma Aldrich; TRCN0000030094)
-
bioRxiv - Neuroscience 2024Quote: ... TRC mouse Rubicon shRNA (Sigma Aldrich; TRCN0000283271), TRC mouse Mtmr2 shRNA (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... lentiviral particles were generated by transfecting HEK293T cells with 6 μg PLKO.1 scramble control and MISP-targeted shRNA plasmids (SIGMA; TRCN0000422523, TRCN0000116527), 4 μg psPAX2 packing plasmid (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: SDC3 was stably knocked down in C2C12 myoblasts by transfecting cells with a plasmid containing an shRNA sequence that targets SDC3 (Sigma, Mission # TRCN0000071990) to generate the SDC3-depleted (S3kd ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1.8 µg pCMV-VSV-G (lentiviral envelope plasmid) and 2 µg purified shRNA DNA with 12 µg (3:1) of X-tremeGENE transfection reagent (Sigma Aldrich, #6366244001). Following 72 hours of transfection ...
-
bioRxiv - Systems Biology 2023Quote: Non-replicating shRNA lentivirus were generated in HEK293FT cells transfected with MISSION plasmids procured from Sigma-Aldrich (details in Supplementary Table 2). Transfection involved the combination of MISSION plasmid (6 µg) ...
-
bioRxiv - Cancer Biology 2022Quote: Individual shRNAs were obtained from the MISSION shRNA Library from the RNAi Consortium TRC1.0 in the pLKO.1 vector (SIGMA):
-
bioRxiv - Cell Biology 2019Quote: A GFP-expressing MDA-MB-231 cell line lacking functional Nav1.5 expression was produced previously by transduction of recombinant lentivirus for shRNA targeting Nav1.5 (MISSION pLKO.1-puro shRNA transduction particles; Sigma) (Nelson ...
-
bioRxiv - Microbiology 2022Quote: The shRNA library originated from the Broad institute Genetic Perturbation platform and individual shRNA clones were purchased from Sigma in an pLKO or pLKO_TRC005 context (3 shRNA per genes for a total of 419 genes ...
-
bioRxiv - Neuroscience 2021Quote: ... a craniotomy was performed under isoflurane anesthesia and 0.5 μL of lentiviral GPR83 shRNA or control shRNA particles (109; Sigma Mission Lentiviral Transduction Particles ...
-
bioRxiv - Immunology 2024Quote: ... Two different Mission lentivirus-based plasmids of shRNAs (clone numbers TRCN0000123050 and TRCN0000436778) against human ZBP1 and the shcontrol vector TRC2 pLKO.5-puro nonmammalian shRNA (SHC202) were obtained from Sigma-Aldrich (Burlington, MA). 293T cells were cotransfected with the shRNA and packaging plasmids psPAX2 and pMD2 using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... containing between three and five expression constructs each encoding target-specific 19-25 shRNAs or a single shRNA (Sigma Aldrich). HAP1 cells were plated at 120,000 cells per well (∼40% confluency ...