Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Carbamic acid 2 4 hexadienyl 1 1 dimethylethyl ester E E 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to Immobilon-E PVDF Transfer membrane (Sigma, IEVH85R). Blocked the membrane with 5% skimmed milk and incubated with primary antibody i.e. ...
-
bioRxiv - Microbiology 2022Quote: ... 0.2 U Pyrophosphatase (E. coli, MFCD00131379 from Sigma-Aldrich®), 0.127 mg.ml−1 MtATPS ...
-
bioRxiv - Neuroscience 2022Quote: ... or lipopolysaccharide (LPS, Sigma-Aldrich, E. coli, O111:B4, L4391) dissolved in PBS at a dose of 5 mg/kg (cohort 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... sectioned (3 μm sections) and stained with H&E (Sigma). LLC tumor samples and dorsal skin were embedded in 3.5- 4 % agar ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barium – gelatin mix (E-Z-EM Canada Inc; Sigma-Aldrich) was perfused until consistent pressure matching RVSP was obtained ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Microbiology 2024Quote: ... and sections stained with H&E (Sigma-Aldrich, Darmstadt, Germany). Slides were scanned using Aperio AT Turbo (Aperio ...
-
bioRxiv - Microbiology 2024Quote: ... or 2μg/well lipopolysaccharides (from E. coli 0128: B12, Sigma) in 9.6 pH bicarbonate buffer overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/ ml epidermal growth factor (Sigma-Aldrich, e-4127), 0.5 µg/ ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... or 0.1mg/kg LPS (E. Coli O111-B4; Sigma, L3024) diluted in PBS ...
-
bioRxiv - Neuroscience 2021Quote: Cre-mediated recombination was induced via intraperitoneal injection of 4-hydroxytamoxifen (50:50 E and Z isomers, Sigma-Aldrich) dissolved in sunflower seed oil ...
-
bioRxiv - Immunology 2023Quote: ... were plated in P96 plates and infected overnight with BCG at an MOI of 10 or Mtb at an MOI of 1 or stimulated overnight with 100 ng LPS (from E. Coli 011: B4, Sigma) and 10 µM nigericin sodium salt (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... tissue supernatant and serum were incubated 1:1 in 2% Trichloroacetic acid (Millipore Sigma: T9159) overnight (4°C) ...
-
bioRxiv - Neuroscience 2021Quote: ... the NMDA glutamate receptor antagonist [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Immunology 2020Quote: ... siLP cells were released by digestion of the tissue with RPMI/4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) supplemented with 60 μg/ml DNaseI (Sigma), and 400 ng/ml of Liberase (Roche Applied Science ...
-
bioRxiv - Microbiology 2021Quote: ... The bacterial pellet was re-suspended in ice-cold 100 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid) buffer (pH 8.0) containing complete protease inhibitor cocktail (Sigma, USA) and PMSF (phenylmethanesulphonyl fluoride ...
-
bioRxiv - Biochemistry 2022Quote: ... and cell pellets were collected and resuspended in the resuspension buffer containing 20 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Sigma) pH 7.4 and 200 mM NaCl (Sigma)] ...
-
bioRxiv - Cell Biology 2021Quote: ... 10−4 M L-ascorbic acid 2-phosphate (Sigma-Aldrich); 1X Penicillin-Streptomycin (Life Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 Trolox® (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma) and 10 HEPES (250 mOsm ...
-
bioRxiv - Cell Biology 2021Quote: ... stained with Orange G (2% in 1% phosphomolybdic acid; Sigma-Aldrich) for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% non-essential amino acids and 0.1 mM 2-mercaptoethanol (Sigma) for EB formation ...
-
bioRxiv - Genetics 2020Quote: ... L-ascorbic acid 2-phosphate(213µg/ml,113170-55-1,Sigma) and Oryza sativa-derived recombinant human albumin(500µg/m,HY100M1,Healthgen Biotechnology Corp) ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mM 2-mercaptoethanol) containing 5 μM retinoic acid (Sigma, R2625) and 2 mg/ml doxycycline (TargetMol ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% L-ascorbic acid-2-phosphate (ASAP; Sigma-Aldrich, The Netherlands) and 1 ng/ml basic fibroblast growth factor (bFGF ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were precipitated with 1:4 trichloroacetic acid solution (TCA, Sigma Aldrich) and washed with acetone ...
-
bioRxiv - Biophysics 2021Quote: ... anaesthetized with 0.02% aminobenzoic acid ethyl ester (tricaine, Sigma-Aldrich) and dechorionated using tweezers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 μM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 μM ethylene glycol bis (succinimidyl succinate ...
-
bioRxiv - Immunology 2020Quote: ... or 0.02% buffered aminobenzoic acid ethyl ester (tricaine; Sigma Aldrich, Zwijndrecht ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis (succinimidyl succinate ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µM 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma-Aldrich), 100 µM ethylene glycol bis(succinimidyl succinate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl of 0.5 nmol α-Cyano-4-hydroxycinnamic acid (4-CIN, Sigma Aldrich, Cat #: C2020) dissolved in ACSF containing DMSO (Wang ...
-
bioRxiv - Developmental Biology 2023Quote: H&E and tartrate-resistant acid phosphatase (TRAP) staining were performed according to the manufacturer’s protocols (Sigma, St. Louis, MO, United States) as described earlier [25] ...
-
bioRxiv - Cell Biology 2021Quote: ... nitrocellulose membranes were incubated with primary antibodies against α-E catenin (1: 1000; Cell Signalling Technologies, catalogue number # 240) and α-tubulin (1: 20 000; Sigma–Aldrich, catalogue number T6074) at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) was added to the cell suspension ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma) was used to show nuclei clear and dyed for 5 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6′-diamidino-2-phenylindole (1:3000; Sigma-Aldrich) was used to counterstain sections and coverslips were mounted using Fluorogel l (Electron Microscopy Sciences ...
-
bioRxiv - Bioengineering 2020Quote: ... 9µL antibody solutions in phosphate buffered saline (PBS) at 1-2 mg/ml were combined with 1 µL 2mM dibenzocyclooctyne-PEG4-N-hydroxysuccinimidyl ester (Sigma, Catalog # 764019) in dimethylsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... CF 568 succinimidyl ester (1:100,000) (Millipore sigma, #SCJ4600027), to create a whole-cell mask for segmentation ...
-
bioRxiv - Molecular Biology 2023Quote: ... L-Leucyl-L-methyl ester (LLOMe, 1 mM, Sigma), zymosan (Sigma).
-
bioRxiv - Bioengineering 2023Quote: ... along with 5% 2-hydroxy-1-[4(hydyroxyethoxy)phenyl]-2- methyl-1-propane (Irgacure 2959; Sigma-Aldrich) photoinitation ...
-
bioRxiv - Biophysics 2021Quote: ... cell monolayers were allowed to migrate for at least four hours before exchanging the medium with pre-warmed medium containing 10 μg/ml E-cadherin blocking antibody (clone DECMA-1, Millipore MABT26).
-
bioRxiv - Immunology 2020Quote: ... 180 uL of co-culture media (RPMI-1640 media containing 1% FBS, LPS (100 ng/mL; from E coli, Sigma-Aldrich) and IFNɣ (100 ng/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... the broad-spectrum hydroxamate metalloproteinases inhibitor CT1746 (100 µM) and the protease inhibitor cocktail (a mixture of aprotinin, bestatin, E-64, leupeptin and pepstatin A, 1/1000)(SIGMA, P1860) with or without 20 nM Wnt5a in the presence or absence of 500 nM RAP for 3 h at 37 °C ...
-
bioRxiv - Systems Biology 2023Quote: ... All E. coli strains (a gift from Dr. Christian Rudolph) were routinely grown in modified Luria Broth (LB) (1% tryptone (Sigma-Aldrich), 0.5% yeast extract (Sigma-Aldrich) ...